Transcript asmbl_39883

Sequence
Transcript Sequence for observation asmbl_39883 of TGE0005367:
CGAACCTGCGCCCGGGGAGCGGCGCGCAGAGGGCACCGGGCGCCGGGAGCAGGCGGCGCAGCACCAGCATTGTGTAGTGTTGGGAGGTCACTGTGTAAGCAAGCTGAGAGGGAAACTGAGGCAAGATGTCGGGCCGGAGCGGGAAGAAGAAAATGTCTAAGCTGTCCCGTTCAGCCAGGGCTGGTGTCATCTTCCCAGTGGGGAGACTGATGCGTTACCTGAAGAAAGGGACATTCAAGTACCGGATCAGCGTGGGTGCTCCCGTATACATGGCAGCAGTCATCGAGTACCTAGCAGCGGAAATTCTAGAATTGGCTGGGAATGCCGCAAGGGACAACAAGAAGGCCCGCATAGCCCCAAGACACATCCTGTTGGCAGTTGCCAATGATGAGGAGCTCAATCAGCTGCTAAAAGGAGTGACCATCGCCAGTGGAGGTGTCCTGCCCAGAATTCACCCTGAACTGCTGGCCAAAAAGCGAGGGACCAAAGGCAAGTCGGAAACCATCCTCTCCCCGCCCCCAGAGAAAAGGGGAAGAAAGGCCACGTCAGGAAAGAAGGGGGGCAAGAAATCCAAGGCTGCCAAACCACGGACGTCCAAAAAGTCCAAAGCAAAGGACAGTGATAAAGAAGGAACTTCAAATTCCACTTCTGAAGATGGGCCAGGGGATGGATTCACCATTTTGTCTTCTAAGAGCCTTGTTCTAGGGCAGAAGCTGTCCCTGACCCAGAGTGACATCAGCCATATTGGCTCTATGAGAGTGGAGGGCATTGTCCACCCAACCACAGCCGAAATTGACCTCAAAGAAGATATAGGTAAGGCCTTGGAAAAGGCTGGGGGAAAAGAGTTCTTGGAAACAGTAAAAGAGCTCCGCAAATCCCAGGGCCCTTTGGAAGTTGCTGAAGCCGCCGTCAGCCAATCCAGCGGACTTGCAGCTAAATTTGTCATCCACTGTCACATCCCTCAGTGGGGCTCCGACAAATGTGAAGAGCAGCTTGAAGAGACCATCAAAAACTGCCTGTCAGCGGCAGAGGACAAGAAGCTAAAGTCTGTTGCCTTCCCACCCTTCCCCAGTGGCAGAAACTGCTTCCCCAAACAGACGGCCGCCCAGGTAACCCTCAAAGCCATCTCAGCCCATTTCGACGACTCAAGTGCATCCTCGTTGAAGAACGTCTACTTCCTGCTCTTCGACAGCGAGAGCATCGGCATCTACGTGCAGGAGATGGCCAAGCTCGACACCAAGTAGCCGCCTCAGCCACGGCTGCACTTT