Transcript asmbl_39882

Sequence
Transcript Sequence for observation asmbl_39882 of TGE0005367:
CGAACCTGCGCCCGGGGAGCGGCGCGCAGAGGGCACCGGGCGCCGGGAGCAGGCGGCGCAGCACCAGCATTGTGTAGTGTTGGGAGGTCACTGTGTAAGCAAGCTGAGAGGGAAACTGAGGCAAGATGTCGGGCCGGAGCGGGAAGAAGAAAATGTCTAAGCTGTCCCGTTCAGCCAGGGCTGGTGTCATCTTCCCAGTGGGGAGACTGATGCGTTACCTGAAGAAAGGGACATTCAAGTACCGGATCAGCGTGGGTGCTCCCGTATACATGGCAGCAGTCATCGAGTACCTAGCAGCGGAAATTCTAGAATTGGCTGGGAATGCCGCAAGGGACAACAAGAAGGCCCGCATAGCCCCAAGACACATCCTGTTGGCAGTTGCCAATGATGAGGAGCTCAATCAGCTGCTAAAAGGAGTGACCATCGCCAGTGGAGGTGTCCTGCCCAGAATTCACCCTGAACTGCTGGCCAAAAAGCGAGGGACCAAAGGCAAGTCGGAAACCATCCTCTCCCCGCCCCCAGAGAAAAGGGGAAGAAAGGCCACGTCAGGAAAGAAGGGGGGCAAGAAATCCAAGGCTGCCAAACCACGGACGTCCAAAAAGTCCAAAGCAAAGGACAGTGATAAAGAAGGAACTTCAAATTCCACTTCTGAAGATGGGCCAGGGGATGGATTCACCATTTTGTCTTCTAAGAGCCTTGTTCTAGGGCAGAAGCTGTCCCTGACCCAGAGTGACATCAGCCATATTGGCTCTATGAGAGTGGAGGGCATTGTCCACCCAACCACAGCCGAAATTGACCTCAAAGAAGATATAGGTAAGGCCTTGGAAAAGGCTGGGGGAAAAGAGTTCTTGGAAACAGTAAAAGAGCTCCGCAAATCCCAGGGCCCTTTGGAAGTTGCTGAAGCCGCCGTCAGCCAATCCAGCGGACTTGCAGCTAAATTTGTCATCCACTGTCACATCCCTCAGTGGGGCTCCGACAAATGTGAAGAGCAGCTTGAAGAGACCATCAAAAACTGCCTGTCAGCGGCAGAGGACAAGAAGCTAAAGTCTGTTGCCTTCCCACCCTTCCCCAGTGGCAGAAACTGCTTCCCCAAACAGACGGCCGCCCAGGTAACCCTCAAAGCCATCTCAGCCCATTTCGACGACTCAAGTGCATCCTCGTTGAAGAACGTCTACTTCCTGCTCTTCGACAGCGAGAGCATCGGCATCTACGTGCAGGAGATGGCCAAGCTCGACACCAAGTAGCCGCCTCAGCCACGGCTGCACTTT