Transcript asmbl_39825

Sequence
Transcript Sequence for observation asmbl_39825 of TGE0003333:
ACGCCGGCACCGCCCGGGGTCCTTCCGTACGCATTGATATGATTGGCCGGCGAAGAGTGGCTCTCTTTTCCTCCTTGGCTGCTTGAAGGCCTTCTGCCATCATGAATGACACAGTAACTATCCGGACCAGGAAGTTCATGACCAATAGGCTACTTCAACGGAAACAAATGGTCATCGATGTTCTTCATCCTGGAAAGGCAACAGTACCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCAGATGTCATTTTTGTATTTGGATTCCGAACCCATTTTGGTGGTGGCAAGACAACCGGCTTTGGCATGATTTATGATTCCTTGGACTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCAAGAAAACAGCGAAAGGAACGCAAGAACAGGATGAAGAAAGTTAGAGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGCTGGAGATTGGACAACAGAAGGAGTAAAGATTCGTCAGTGACTCTGGTGATCAGATTCTTCATGAGAGGATTAATAAACTAATAACTTTTA