Transcript asmbl_39736

Sequence
Transcript Sequence for observation asmbl_39736 of TGE0005343:
TTAAAGGGAGCTCCCGGCACCGCTCGCAGGTCCAGTTTCCGCAGTGCGCACGCGCAAGGGTATCTTGTCAGTCGGCGCCGCGTGCGGGCCGGTGGCTCTGTAGCAGCGGCGGCGGCTAGTCTCCGGCACCATGAGCGGCTTCAGCAGCGAGGAGCGCGCCGTGCCCTTCACCCTCGAGTACCGAGTCTTCCTAAAAAATGAAAACGGACAATATATATCTCCATTTCATGATATTCCAATTTATGCAGATAAGGATGCGTTCCACATGGTAGTTGAAGTACCACGCTGGTCCAATGCAAAAATGGAGATTGCTACAAAGGACCCTTTAAACCCAATTAAACAAGATGTGAAAAAAGGAAAACTTCGTTATGTTGCAAATTTGTTCCCTTATAAAGGATATATCTGGAACTATGGTGCCATCCCTCAGACTTGGGAATACCCAGGACACAATGACAAACACACTGGCTGTTGTGGCGATAACGACCCAATTGATGTGTGTGAAATTGGAAGCAAGGTATGTGCAAGAGGTGAAATAATCAGGGTGAAAGTTCTAGGCATATTGGCTATGATCGATGAAGGGGAAACTGACTGGAAAGTCATTGCCATTAATGTGGATGATCCTGATGCAGCCAATTATAATGATATTAATGATGTCAAGAGGCTGAAACCTGGCTACCTTGAAGCTACAGTGGACTGGTTTAGAAGGTACAAGGTTCCTGATGGAAAACCAGAGAACCAGTTTGCTTTCAATGCAGAATTTAAAGATAAGGACTTTGCAGTTGATATTATTAAAAGCACTCATGACCTTTGGAGAGCCTTAGTGACGAAGAAAATTGATGGAAAAGGAATCAGTTGCATGAACACCACAGTGTCTGAGAGCCCCTACAAGTGTGATCCTGAGGTGGCCAAAGCCATTGTGGATGCTTTACCACCACCATGTGAATCTGCCTGCACAGTACCAACAGATGTAGATAAGTGGTTCCATCACCAGAAAAACTAAGGAAATTTCTCTGGAATACAAGCTGATACTGCAGCATCCTATTCATCTGGGAGTATTAGATGCAAAAGTAGTGGCTTTTCAAAGCTTTGAATATACAGAACTAATCTAACAAAGCAAATTCTGCTGTGACCAATCCAGTATATTCAGCATGTTATCTAAAAGCATTTTTTCATATCAACTCAGATAACTCTTGGTACATGCTTAAATATCAAAGCAGTTGTAATTTAGAAGTCATTTGTGAATAAATGTGCAAGATAAGTACATATTGGATGTATATGTGTTAGAAATAAAATTATTTTGCTGAAA