Transcript asmbl_13724

Sequence
Transcript Sequence for observation asmbl_13724 of TGE0000195:
AGGAGGGAGGCGGTGGTAGCGGCGGCGGCTGCTGAGGAGGAGGAGGGGGAGCGGAGGGAGGTGTTTCTGTCAGTTCCGGCTGTTTGTTCGGGAAGTGGATCCGCCGCTGCCGGAGCAGCCCGAAGGGAGCTGCGGATCGCGAGGCCAGTACCGACCCCGCCCGCCCGCGCGCACCGCCCCCGCCCGCCATGGCCCGGGACTACGACCACCTCTTCAAGCTGCTCATCATCGGCGACAGCGGTGTGGGCAAGAGCAGTTTACTGTTGCGTTTTGCAGACAACACTTTCTCAGGCAGCTACATCACCACGATCGGAGTGGATTTCAAGATCCGGACCGTGGAGATCAACGGGGAGAAGGTGAAGCTGCAGATCTGGGACACAGCGGGGCAGGAGCGCTTCCGCACCATCACCTCCACGTATTATCGGGGGACCCACGGGGTCATTGTGGTTTACGACGTCACCAGTGCCGAGTCCTTTGTCAACGTCAAGCGGTGGCTTCACGAAATCAACCAGAACTGTGATGATGTGTGCCGAATATTAGTGGGTAATAAGAATGACGACCCTGAGCGGAAGGTGGTGGAGACGGAAGATGCCTACAAATTCGCCGGGCAGATGGGCATCCAGTTGTTCGAGACCAGCGCCAAGGAGAATGTCAACGTGGAAGAGATGTTCAACTGCATCACGGAGCTGGTCCTCCGAGCAAAGAAAGACAACCTGGCAAAACAGCAGCAGCAACAACAGAACGATGTGGTGAAGCTCACGAAGAACAGTAAACGAAAGAAACGCTGCTGCTAATGGCACCCAGTCCACTGCAGAGACTGCACTGCGGTCCCTCCCCCAGCCCGAGGCCCACGGAGGTTCCTCGGGGGACAGTCTCAGTTTCGTGCCGTTATTTAAAGAATTCTCTCCATGTTTTTGTATCGGGAGGTGCCATCGGCACTTCCTCCCCCGCCCTCCTCGAGTGCCAAGAAGGTGTTGGACCAGCCCGCCCTTCCCTACTGGTGCCCCCTCCTCCCCGGCCAAGGCGCCTGGACCTGGCGAGGACGCTGCCCGCCGAGCGGACTGATTCGCAGAGTCTGTACATAGTGTATATTGCTCTACCCGGCCGCACACCACGTCCTGCTCTGGCTTTTGCCTTCTTGATGCCAGCCTGCTGCAACAGACCCTCCCCGCGCCCCTCCCCAGCCCATCTTACTGCAAGCAGCGTCCTGAGGAGACAGCGGCACGTTCTAGCTGCGTCTGCGGCCAGCCCGTGCCAGTGGAGTGGGCTCCGCGTTGCTCATTCTCTCCGACAGGTTGTCAGCCTCTGTCCCCGCTGCACAGGGTCTTGCCCCTTCTCCGGGGCCTGTGCCAGCTCCCTTCCCTCCCCGTTGTCCTGTCCCCACAGCCATTCTGGGAGCTGGGGAACCTGGTCTCAAGGCAGGCCCTGCAGTTCCACAGAGGTGGCAGGTCTTGCCCTTTGGCCAACAGATTTCTTGTCCTGCCTTCTAGATGCCTCTGAGCTCCAAACCCAGGGCAGCCATGGCTTCTCATTTACACCAACAGGTTTCAGTTCCAACAGAAAGGTCGGGGTAGGTTCGTGCAGAGATGGGGCTGGCAGGGGGGCTATGGGAGGATTATTTTAACAGATCAAGAAAATGAAGCCAAATCAAGTGAATTAAATTCCTCACAATTATTTTCTTTCCCTGAGGTTTGATTGGCACAGCAGCAAAAGTTGAGGCCACCCCACTTGTGTCCACTGTTTTTAGAAAAAAATGAATGGCTTCCTGCCATTGTGGGGCTGGACTCTTGGGCTTTCTTGGTGGGAGCGGAGAAGGGGCCTCCCACCCTTGTCCGAGTTGCCTCCCACTGGAGGTCAGGAGTCTACACTGCAGCCTCGGGCACTGTGGGGAGTGCATGCCTGGGGCCTCTGGGTGGGGACCATGGACAGGCCCTGGTCACTGTCCTAACCTTTGTCAGGACAAAGGTAGCAAGAGGATTTCCTGGCGGGTGGGAAGGAATGGCTGGGGCGGCCAGTTTTGACACGCCCCAGTGCCCTGGAGAACAACCAGGGTCATCTGCACTTGATGACTGCTCCCCGACCCCCAGCCCGGACACCTCATTCCCCTCCCACTACAGGGATCAAGTGACCTGGGAAGAACCGAGTTTAACACCAGGATGTGTTTCCTTAGATTTCCTTTCCTAGGCGATTTCCAGGGAGAGCCCTGATTGGACAATCACATCACAGATCACACTGCAGTTTCCATGTTAGCACTGTGGATGGGTTTTTAATCAATAAAAACTGGGGGTTTCTTCTCACCGACTCTCCACTTGCCCAAACTGCCAAAAGCTGGTGATTCTGGGACAGGCCTTCACTTTGGAGCCACGGGATGGGGTGGGGGAGCCCCATGGGCCTGGGAAGGAGGGTGCTGTGGAGGGGGCTGCAGGGCTGACCAGCAGGCAGCCTCATCTGGTCGGGGGCGGGGGCGGCAGGAGCAGAAGCGGGGTCTCCGTCCTTGGGACTGTCCTGGTTGGCCACGGGCCCTGAGGATGCACGGTGCCTGGGGCTCCTGTGCCGGTGGGCGGGGGGCATGCTGGCCTCTGAGCGATCAGGCGAGGCCAGCGAGGGTGTGCTTGCAAATTCAAGCAATAAGAGGGGGGTTCCTGGGGGCTTCCAGCCCAGGCTAGAAGCCCCCATGGCTTCTGGCAGCTGGACATCAGCCCCAGGTATTGGGGTGATTTTGGTCATGACAGTGTGCCTGTCCCACTGTTACACGCATGAATGGGGGTTATGGGGTGGGGGTGGGGACTCAGGGCTGGACCGACGTCCTAGTGGACCTGATGTGAAATTCCTGTCAAACAAACACCACTTTTCAATGGTTTGCTAGGAGTATTTCTGTATTGAAAGTTTCTAATTATGCTTTTTAAAAAAATACTAAAAATAAAGGTTCAAGCTG