Transcript asmbl_38566

Sequence
Transcript Sequence for observation asmbl_38566 of TGE0000454:
GTCTTGACAATAAAAAAAAAAGATTCCTTTTCAAGTTCCGAAAAATTCCCTGTGTATCTCATCGCCCTTATCCAAGATGGCTGAAACAGAGTCGGTATCTGCTCTAGCTGCCGGAAATATGTGAGCCTCTATGGTCTAAAAGGCTCTTTCGCGGTGCGTTTCTGACGACTTCCGGCGGCTCTTCTCGCGGGTATTGGCTGTTGGCGGCGTTGTGGCTAAGCTCGTGTGCGGCGGCAGTGTCGGCGGCGGCTGCAGCGAAAGAGTTTGGCGCGATGTCTCACACCATTTTGCTGGTACAGCCTACCAAGAGGCCAGAAGGCAGAACTTACGCTGACTATGAATCTGTGAATGAATGCATGGAAGGCGTTTGTAAAATGTATGAGGAACATCTGAAGAGAATGAATCCCAACAGCCCCTCTATCACGTATGATATCAGTCAGTTGTTTGATTTTATTGATGATCTGGCAGACCTCAGCTGCCTTGTTTACCGAGCTGATACCCAGACATACCAGCCTTATAACAAAGACTGGATTAAAGAGAAGATCTACGTGCTCCTTCGTCGGCAGGCCCAGCAGGCCGGGAAATAGTTGTATTGGAAGGGGATGGGAGTGGGGTGGAACACAGGTGTGTACAGCGTGCTGTAGTGGAAGTTTTGTATTATAGTAATCCTGTTTCCATTTTGGTACACTCTAGCCAGGATCGAATGTATTAGATGAAATGTGAGGATCTTGTTCAATCTGAAACCCCTGTCACCCCCTTTTTTTTCTTTCTTTCCTTTTTTTTACTTAAATATTTTTATGATTATTTAGATGGAAGTTGTTCTTTGTCAGATAATGTTGATTCCAATCCTTCAAAAACTCTTCATATCTGCTATATAACATTCACTGTACTAACCCTTCTTCAAGTTGAAGGGGGGGGTGGTGGCACAGGTTAGTTATGTCCTCAAGATACAGTCTAGTGAAAAACAAATAAATGTTCTTTAGTTATA