Transcript asmbl_38563

Sequence
Transcript Sequence for observation asmbl_38563 of TGE0015942:
CCGCTCAGTGTGCGTGGAGATTAGGTCCGAGCGCCCGCCCCGAGGCAGGCAGTTCGCGAGCTCAAGCCGCCGCCGCCGCCAGCAGCCACCTTCGCAAGCAGCGCCGCGGCGGAACCGGGCGCAGGGGAACTAGCCCGGCCCCGCCAGTCCAACCCAGCCCAGCCCGACTCCCTCCCCACGCCGAGGCAGCCGCTGCCGCCAGGAGAGAAGGTGGAGGAAGAAATCCAGCCCCTAGCACGCGCGCACCATCATGGACCATTATGATTCCCAGCAAACCAACGACTACATGCAGCCCGAAGAGGACTGGGATCGAGACCTGCTACTGGACCCGGCCTGGGAGAAGCAGCAGAGAAAGACATTCACGGCGTGGTGCAACTCCCACCTCCGCAAGGCGGGGACGCAGATCGAGAACATCGAGGAGGACTTCCGGGACGGCCTGAAGCTCATGCTGCTGCTGGAGGTCATCTCAGGTGAACGTCTGGCCAAGCCGGAGAGAGGCAAAATGAGGGTACATAAGATCTCCAATGTCAACAAGGCCCTGGACTTCATAGCCAGCAAAGGGGTCAAGCTGGTGTCCATTGGAGCGGAAGAAATTGTGGACGGGAACGTGAAAATGACCCTGGGCATGATCTGGACCATCATCCTCCGCTTCGCCATCCAGGACATCTCTGTGGAAGAGACTTCGGCGAAGGAAGGGCTGCTCCTGTGGTGTCAGAGAAAGACAGCCCCTTATAAAAATGTCAACATCCAGAACTTCCACATAAGCTGGAAGGACGGCCTTGGCTTCTGTGCCTTGATCCACCGACATCGGCCTGAGCTGATTGACTATGGGAAGCTGCGGAAGGATGATCCACTCACAAATCTGAACACGGCCTTCGATGTGGCAGAGAAATACCTGGACATCCCCAAGATGTTGGATGCTGAAGACATCGTTGGGACCGCCCGACCAGATGAGAAAGCCATCATGACTTACGTGTCCAGCTTCTACCATGCCTTCTCCGGAGCCCAGAAGGCGGAGACAGCAGCCAATCGTATCTGCAAGGTGTTAGCTGTCAACCAGGAGAATGAGCAGCTCATGGAAGACTACGAGAAGCTGGCCAGTGATCTGCTGGAGTGGATCCGCCGTACCATCCCGTGGCTGGAGAACCGGGCGCCCGAGAACACCATGCACGCCATGCAGCAGAAGCTGGAGGACTTCCGCGACTACCGGCGCCTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCTGCCTTCATGCCCTCCGAGGGCAGGATGGTCTCGGACATCAACAATGCCTGGGGCTGCCTGGAGCAGGCAGAGAAGGGCTATGAGGAGTGGCTATTGAACGAGATCCGGAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACGGACGGCAAAGAGGCCATGTTGCGGCAGAAGGATTACGAGACGGCCACGCTTTCGGAGATCAAGGCCCTGCTCAAGAAACACGAGGCCTTTGAGAGTGACCTGGCTGCCCACCAGGACCGCGTGGAGCAGATTGCTGCCATCGCACAGGAGCTCAATGAGCTGGACTATTACGACTCACCCAGTGTCAACGCCCGGTGCCAAAAGATCTGTGACCAGTGGGACAATCTGGGGGCCCTAACCCAGAAGCGGAGGGAAGCCCTGGAGCGGACTGAGAAACTGCTGGAGACCATTGACCAGCTGTACTTGGAGTATGCCAAGCGGGCCGCACCCTTCAATAACTGGATGGAGGGGGCCATGGAGGACCTGCAAGACACCTTCATCGTGCACGCCATTGAGGAAGTCCAGGTGCGCTGCGGCCCCCCCACCCCGGAGGCCGGCTCCCCCAGCTGCCCACGGCCTAACTCTT