Transcript asmbl_36928

Sequence
Transcript Sequence for observation asmbl_36928 of TGE0015877:
CCGGCCGCCATTTTGTGCAGTCGCCGGGAAGGAAGGAGACGCCTAACCCGCGGTATCGCCGGGTTTGAGCGTAGCCAAACCTACCCACTAACTTTATAATCCCGATTCTCTGTGTTTTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGAGAGCGCCGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCATCGGTCGTCACCAGACCGGAGCCGCAGGCCCTCCCGAGCGCGGCCATCCGTGCCCCGCTCCCAGATCTTTACCCATTTGGGACCATGCGCGGAGGCGGCTTTGGGGACCGGGACCGGGATCGTGACCGTGGAGGATTTGGAGCAAGAGGTGGTGGTGGCCTTCCTCCGAAGAAATTTGGTAATCCTGGGGAGCGTTTGCGTAAAAAGAAGTGGGATTTGAGTGAGCTCCCCAAGTTTGAGAAGAATTTTTATGTGGAACATCCAGAAGTGGCACGGCTGACTCCATATGAGGTTGATGAACTACGTCGTAAGAAGGAGATAACAGTGAGAGGGGGAGATGTTTGTCCTAAACCTGTGTTTGCCTTCCATCATGCTAACTTCCCACAGTATGTAATGGACGTATTGATGGATCAGCACTTCACAGAACCAACTCCAATTCAGTGCCAGGGATTTCCATTGGCTCTTAGTGGCCGGGATATGGTGGGCATTGCTCAGACCGGCTCTGGGAAGACACTGGCGTATTTGCTGCCTGCAATTGTTCATATTAACCACCAGCCATACTTGGAAAGGGGAGATGGTCCAATCTGTCTGGTCCTGGCTCCTACTAGAGAGCTTGCCCAACAAGTACAGCAGGTGGCTGATGACTATGGCAAATGTTCCAGATTGAAGAGTACTTGCATTTATGGAGGTGCTCCTAAAGGTCCCCAGATTCGAGACTTGGAGAGAGGTGTTGAGATCTGTATAGCTACTCCTGGGCGCCTGATAGATTTCTTGGAGTCGGGAAAGACAAATCTTCGCCGATGTACCTACCTTGTACTGGATGAGGCTGACAGAATGCTTGATATGGGTTTTGAACCCCAGATTCGTAAAATTGTTGACCAAATCAGGCCTGATAGGCAGACACTGATGTGGAGTGCAACCTGGCCAAAAGAAGTAAGACAGCTTGCAGAGGACTTCCTTCGTGATTACACCCAGATCAATGTAGGCAATCTGGAGTTGAGTGCCAACCACAACATCCTCCAGATTGTGGATGTCTGCATGGAAAGTGAAAAAGACCACAAATTGATCCAACTCATGGAGGAAATAATGGCTGAAAAGGAAAATAAGACAATAATATTTGTAGAGACGAAGAGACGCTGTGATGACCTCACTCGAAGGATGCGCAGAGATGGTTGGCCAGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAGAGAGATTGGGTACTTAATGAGTTCCGTTCTGGAAAGGCTCCCATCCTCATTGCCACAGACGTAGCCTCCCGTGGGCTAGGTTCTCCGGCGCTTGGCAACCAAATGGGGCTACAGAGAAGCATCTAAGCCAGTTCACAGAGCGAGCGTGTGTGGGGACTTCTCACTGCCACGGACCCTTGATGCATGCTCCCCGCGCTCCAGTGGTCCCGTGTCAGAAGGCGGAGTTTTCGAAAGGAGGCCGCCAAATATAAAAGGCAGAGAGACGGGATCGGCTGCAGCGGTTTCCCACAGGAGGAGGGAGTGTGCATCGGTCTGGTAACAAACAGAGAATGTTTCTTAATTACTTCTATCACAAAAATCTGTGTTTTATCTAGGATATTTTCTGAATATTCTTTGTAAAATGCAGATTTTTTTTCCACAAAACATTAGGAGTCTTTGTTATAGTCTTAAATTTGTTTGTTTAAGTAGGTAAAAATAAACATTTAGCTGAAAGCATTACACTAACATTTACATACTTTAAGCATTAGGAGGTTATTCAACCCAATTCCCAGCAGTGGATAGAACATTAAACTTGTGTCTCAAGGTTTCATGGTTTTTCCCACACTCTTTGGCTATTTAATTTCCCAGGTTACGTAGACAATCAATAATTGAAGCAAGTACTGAGTTAAAATAACCTTGAGTTGAGCAAAAACCTCATTTGGCAGAGCTGGGCTTGGTAGTACAGTGAAATTTTAGTGTAATGTGCTCTTGTGGTAATTGAAAGGGGTATGATAATTTGGTTATTTCTGTGAAGGAAACTAGATGTGTACTTGGGCTCTGATCAGTTTTTAAAATATAAGAGCAAAATTTAATATTTCGATTAAGTCTCCTTTAAAATGTCGTAATAAAGTATATGAAGTTTCTTTTTCATTTTGCTCTGTGACTGGTTTAAAGGTAAGTTTGTTACATTACTGGTAGATTTTGCCAGGCTTCTCCCAACAGAGTAGAAGTGATTTGGCCTTGTAACTTAACGGTGCTACTGTCTTCTACATTCCAGTTTCGAAAAGGATAGAGCTGGAATTTGGTACAACTCCTGTCAGTATATTGGTTAAAATACAGAAGAGGCAGGAGTTTGGATGGTCGAATGGGATTCCCTTAGGGTTTGAAGCTGATAAAGATGCCACTTTCTATGCATGTCCCAAAAATCATTAATCCTCTTTTACTCTGTTGGGATGAGTCTTTTTTTGTTCGTGTTCAGAGTGGTTACTAACTTAATCTTCTCTCCTCTTGCTGTCATCTGCATTCGTGCTTCCTACCTGTTGTTGGCATGTCCTTTACCNNNNNNNNNNCAACCTACACAACAAACCATCTTTGGCTTTGAAGATGTGGAAGATGTCAAGTTTGTGATCAACTATGACTATCCAAACAGCTCAGAAGATTATGTGCACCGCATTGGCCGAACGGCCCGTAGTACCAATAAGGGCACTGCCTACACCTTCTTCACCCCGGGAAACCTAAAGCAAGCCAGAGAGTTGATCAAAGTGCTGGAAGAAGCTAATCAGGCTATTAATCCAAAACTGATGCAGCTGGTGGACCACAGAGGAGGCGGCGGAGGAGGGGGAGGTCGTTCTCGATACCGGACCACTTCTTCAGCCAACAATCCCAATCTCATGTATCAGGATGAGTGTGACCGGAGGCTTCGAGGAGTCAAGGATGGCGGCCGGAGAGACTCTGCAAGCTATCGGGATCGTAGTGAAACCGATAGAGCTGGTTATGCTAATGGCAGTGGCTATGGAAGTCCAAATTCTGCCTTTGGAGCACAAGCTGGCCAATACACCTATGGTCAAGGCACCTATGGGGCAGCTGCTTATGGCACCAGTGGCTATACAGCCCAAGAATATGGCGCTGGCACTTATGGGGCTAGTAGCACCACCTCAACTGGGAGAAGTTCACAGAGCTCTAGCCAGCAGTTTAGTGGGATAGGCCGATCTGGGCAGCAACCACAGCCACTGATGTCACAACAGTTTGCACAGCCTCCGGGAGCTACCAATATGATAGGTTACATGGGGCAGACTGCCTACCAATACCCCCCTCCCCCTCCTCCCCCTCCTCCTTCACGTAAATGAAACCACTCAAGTGGTAGTGACTTGTGCAGACATTACATTTAAAGGAACGCTGTCTTTCCCTTTTTTTTTCTTTCTGTTTTCTTTCTTTTTTTATTTTTCTCCCCTAGCCATTGTGGTTTGTGTTTCTTGGAGATAGTTAGAATTCACTGCCAGGTTTCTTCTGCCCGCCAAATTGATCCCAGTCAGTAATAACAGATTTTGTAAAGATATATATGGCTGACTGGAAGAGATTCCCCCCTCCCTGCCCCCAACTTATTGCATGTGGAGGATGTTTGAGCTATTTTTCATCTTAAAAGAAAAAGCAAGGTATTAGGCCCTTTTGTGGGAACCCTTTTTTGTTGTCCTGAGTTGGGGGTGGGTGGGGGAGGGTAGAGGGTTAAATCTGCAGAAGAAGATGGCATCTGTGCTTTAAACTGCTCTCATTGCCGAGTTAGAGAACCGGAGGGAGCTCCCAGTACATTTTCCATAATGCTTTTTAATGTTTCTCAAGCTGGAACAGGGTTCCTCAGACTTGATGAGTTTTTGAGACAGTGCTTTGGCATTGTCATTTTGGTTGATTGCTTGTTAAGTGCATTCAACAGTTTTAAAAAATTCCTAATTGGTTTTGTCTCCTTTACACTCTGCCTTCCCCCTTCCCAATTACTGAAAATTAACCATTTTAGTGTCAGGTTAGAAATTGAATGGCCGAGTCCAAGTTTAAGTGTATCTTTTAAATTAAAAACCCAAGTGTTTATTGAAATGGTTAACGTAGCATGTCAGCATCTGGTTGGAAGCTGCCTTCCCCCCCGGCCCGCCCCCCCATATAAACAGGGACCATCTGTGAAATTCATTTTCCAGCCAGACAGCTGCTGTGGGCAGAATGAGTATAAATATAAATGCTCACTGGAAATGTTATTAACCAGTTAAGTATGTATTTCACCTGCAGTGTAAAAACCACCTTTAATTCTAAACCGTATACTCAATGGGCAGATTTTTTTTTTAAACTTAGTAGAGCTAGAATAAAAGCAGCTCTTCGCAAGCTCCTCATCCCTTTTAGCCAAGTTACCTTGAATAAAGAATTTCAAGGGTTTATTGAGAGAGGTTTATTCATACTGTGTTCTCTGCAGTGCTTTGTAACAGCTTTTGGATGCAAATTTCCCTCAGCGTCCATTTGCACTCAGTTTTGCAGGTAGTGCTTAAGAAAAGTTATACAGAGGACTAAGATCTAAGTCCTTTTATTTTTCCTCCATCTAAAGGTAGGTGAGTCCATCCCCTTTGTAGTGATAACTGTTTTACCAAGGCTTCTTGGAACAGATAGGCCTGGAAAGAATCTTCTCTTGTGTTTACTGTAACAGGACAGGAAGATCAGACAGCCCCAGAAACCTCTTCCATATCTAGCATGAGACTCTCTAGTGCTGTCATCGGTATTACTTACTCACAATGTACTGAAAGGAGGAAAGAAGGCTCCACTGCATTCTTTGGCTAAGGCCCGAGAGTGCTTACTGGTTTGTAAGATACAGATATCTAAATACTTGAGGTTTTTGTTTTCCTTTTTAAATTCTTCAGGGAGAGAGAAGGGATTGTTTCTGAGGGATTCTGAAAGTTGGTTGAATATGCAACACAGGTAGGTTGTCAGCATAAGCTGAAATATATGCATGTAAGAACTTTGACACCTTCCCCCCGCCCCACTTTCTTCCTTAACTTTTTTTTATCCTCCCCCCTCCGCCCCCCCATAGAAGTTTAGGCCGAGGGAGGGTAGCAGGCACAGGAAAGACGTGGCAAAATTGATCTGTGCTTTCAAACCAAAGTGTCCGCCGCCCCTTCCCCCTGAAATTGTCTAAGCACTAACCTGTCCATTGTAGACGGCGCTACACCAAAATTTTTTGTTTTTTTTTTGTTTTTTTAACAGGTGCCACCAGAGGGGGTGTCCTGCTCTTGCAGGTCTTACAGGCATCCTTTTTGTGGGGAAAAGTCTCTGGGCAAGCAAGCGTTGTTTTTGTTTTGTTTTGTTTTGGTCTGCTGCTTGCTTCTTTTTTCCACCAGGGGTATGGTGTTGTAATCAGTCAAAATAACAGCATATTCCAAATCTCAGGCTGCTGTGGACTGAACACAGCTAGAATCTAGCAGAGTTTTTCCTACAGCTCTAACTCTTCTGCCTCCCTGTTTGTCACTCAATTCAGGTTCTGCCTTTGCTTCAGAACATGAGCAGAAGAGATCTCATTTGAGGCTAGGTATTGCCATCATGGTTGAGACTCATTTAAAGAAAAGATTTCAGTATTGAGCTATGGGGTGCTTCTCCCCAATCCCTAACAGTTCATGTGTGGACTTCTCTCATCTAAAAGGTTGGTGGCTTTTGCTTGGGATCAGTGCTCTCTATTCATGTCCTTGCTGGTCTCTGAACACATTCCTGTTGCGTTAAGACTTGAAAGATTTGTAGGTGTGTGATGTTCAGGCACAGGATGCTAAAAGCTATGTTGCTATTCTTAGTATGTAAATTGTCCTTTTGATACCATCTTGTTTTCTTTTGTAGGTATAAATAAAACACTTGACAATAAA