Transcript asmbl_36835

Sequence
Transcript Sequence for observation asmbl_36835 of TGE0005179:
GTCACGCTGACGACGAGCGAAGGGCACAGATCTAAGGGCTCGGAGGACATTCGGCCTCTGTGAGCTGCAGCCTTTCCGAGGAGCGTCGTCTGTTCGCCATCTTAGGGAAGATGTTCTCGTCCGTGGCGCACCTGGCGCGGGCGAACCCCTTCAACGCGCCTCACCTGCAGCTGGTGTACGATGGCCTCGCAGGCCCTTGCAGCAGCCCCTCCGGACCCCCGGGGCCCCCCCGCCGCTCCCGCAACTTGGCGGCCGCCGCTGTGGAAGAGTACAGTTGCGAATTTGGCTCCATGAAGTTTTATGCACTGTGTGGCTTTGGTGGGGTCTTAAGTTGTGGTCTGACACACACTGCTGTGGTTCCTCTGGATTTAGTGAAATGCCGTATGCAGGTGGACCCCCAGAAGTACAAAGGCATATTTAATGGATTCTCAGTTACACTTAAAGAAGATGGTGTTCGAGGTTTGGCTAAAGGATGGGCTCCGACTTTCATTGGCTACTCTATGCAGGGGCTCTGCAAGTTTGGCTTTTATGAAGTCTTCAAAGTGTTGTATAGCAACATGCTTGGAGAGGAGAACACCTATCTCTGGCGCACATCACTATATTTGGCCGCCTCTGCCAGTGCTGAATTCTTTGCTGACATTGCCCTGGCTCCTATGGAAGCTGCTAAGGTTCGAATTCAAACCCAGCCAGGTTATGCCAACACTCTGAGGGATGCAGCTCCCAAAATGTATAAGGAAGAAGGCATAAACGCATTCTACAAGGGGGTTGCTCCTCTCTGGATGAGACAGATACCATACACCATGATGAAGTTCGCCTGCTTTGAACGGACTGTTGAAGCGTTGTACAAGTTTGTGGTTCCTAAGCCCCGAAGTGAATGTTCAAAGGCAGAGCAGCTGGTTGTAACATTTGTGGCAGGTTACATAGCTGGAGTCTTTTGTGCAATCGTTTCTCACCCTGCTGATTCTGTGGTGTCTGTGCTGAATAAAGAGAAAGGTAGCAGTGCTTCTCAGGTCCTCCAGAGACTTGGATTTAAAGGTGTATGGAAGGGACTCTTCGCCCGTATCATCATGATCGGCACGCTGACTGCACTGCAGTGGTTCATCTATGACTCTGTGAAGGTCTACTTCAGGCTTCCTCGCCCTCCTCCACCCGAGATGCCGGAGTCTCTGAAGAAGAAGCTTGGATTGACTCAGTAGATAGAGCAAAGCAAATATGGACTGAATCTGCTTGTTGGTCAGTGTTGAGGAAAGTGCTAAAGGAACTTTTATATATTTGACAGTGTAGGAAATTGTCTATTCCTGAAATAATTACTGTAGTGCTCTTGCCTAAGGCAAGAGTTTCAAACTTGCTGTTGAAATAAACCCAACTGTTCATGA