Transcript asmbl_36699

Sequence
Transcript Sequence for observation asmbl_36699 of TGE0005158:
CGGGAGGCTGGTCGCGTCACCCACGCCCCCGCCGCGCCCCGTTTCTATAAATTGCGAGCGCAGCCTCCCCCAGCGCTCTCTGCTCCTCCCGTTCTACAGACAGCCGCGTCCTCCTGCGCAGTGCCAGCCGCGACCCTGAGACACGATGGTGAAGGTTGGAGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGCAAAGTGGATATTGTCGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTCTACATGTTCCAGTATGATTCCACCCATGGCAAGTTCAAAGGCACAGTCAAGGCTGAGAATGGGAAGCTTGTCATCAATGGAAAGCCCATCACCATCTTCCAGGAGCGAGATCCCACCAACATCAAATGGGGTGATGCTGGTGCTGAATATGTTGTGGAGTCCACTGGTGTCTTCACTACCTTGGAGAAGGCTGGGGCTCACTTGAAGGGTGGAGCGAAGCGGGTCATCATTTCTGCTCCTTCTGCGGATGCCCCCATGTTTGTGATGGGTGTGAACCATGAGAAGTATGACAACTCCCTCAAGATTGTCAGTAATGCCTCCTGCACCACCAACTGCTTGGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGACTCATGACCACAGTCCACGCCATCACTGCCACCCAGAAGACCGTGGACGGCCCCTCTGGGAAGCTGTGGCGTGATGGCCGAGGGGCTGCCCAGAACATCATCCCTGCTTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAATGGGAAGCTTACTGGCATGGCCTTCCGTGTCCCTACCCCCAACGTGTCAGTTGTGGATCTGACCTGCCGCCTGGAGAAAGCCGCCAAATACGATGACATCAAGAAAGTGGTGAAGCAGGCGTCGGAGGGTCCCCTCAAGGGCATCCTGGGCTATACTGAAGACCAGGTTGTTTCCTGTGACTTTAACAGTGATACCCACTCTTCCACCTTCGATGCTGGGGCTGGCATTGCCCTCAATGACCACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATTTGGCTACAGCAACAGGGTGGTGGATCTTATGGTCCACATGGCCTCCAAGGAGTAAGAGCCCCCTGGACCACCAACCCCAGTGAGAGGAAGAGGCCCTCAGCTCCTGGGGAGTCCTTGCCCCAAATCGATCCCCCAGCATACTGAGTGAGAATCTGACCTCCAGTTTCCATCCCAGACCCCCTGAAGAAGGGGAGGGGCTTAGGGAGCCCTACCTTGTCGTACACCATCAATAAAGTTCACTGTACCCAGCCAA