Transcript asmbl_35754

Sequence
Transcript Sequence for observation asmbl_35754 of TGE0005119:
AGGAAACTTGAACGTAACTTCAAAAGAAGATTTGATTTTTTTGTATCTGGATCACGTATATACAGCAAGACCGTCAGAATGTCGGGAGCCTCAGTGAAGGTGGCTGTCCGCGTGCGGCCCTTCAATTCTCGAGAGACCAGCAAAGAGTCCAAGTGCATCATTCAGATGCAAGGCAACTCCACCAGTATTGTTAACCCAAAGAACCCAAAGGAAGCTCCAAAGTCCTTCAGCTTTGACTACTCCTACTGGTCTCACACCTCGCCAGAAGATCCCTGTTTTGCATCTCAAAACCGAGTGTACAATGATATTGGAAAGGAAATGCTCTTACATGCTTTCGAGGGATATAATGTCTGTATTTTTGCCTATGGGCAGACTGGTGCTGGGAAATCTTACACGATGATGGGTAAACAAGAAGAAAGCCAGGCTGGCATCATTCCACAGCTGTGTGAAGAACTATTTGAGAAAATCAATGACAACTGTAATGAAGACATGTCTTACTCTGTAGAGGTGAGCTACATGGAAATTTACTGTGAAAGGGTACGCGATTTGCTGAATCCAAAAAACAAGGGTAATTTGCGCGTGCGTGAGCACCCACTTCTTGGCCCGTATGTGGAGGATCTGTCAAAGTTGGCAGTCACTTCCTACACAGACATTGCTGACCTCATGGATGCTGGGAACAAAGCCAGGACAGTGGCAGCTACCAACATGAATGAAACAAGTAGCCGTTCCCACGCTGTGTTTACAATTGTTTTCACCCAGAAGAAACATGACGCCGAGACCAACCTTTCCACTGAGAAGGTCAGTAAGATCAGCTTGGTGGATCTAGCGGGAAGTGAACGAGCTGACTCAACTGGTGCCAAAGGGACTCGATTAAAGGAAGGAGCAAATATTAATAAGTCTCTTACAACTCTGGGCAAAGTCATTTCAGCCTTGGCAGAGGTGAGTAAGAAGAAGAAGAAAACTGATTTTATTCCCTACAGGGATTCTGTACTTACTTGGCTCCTTCGAGAAAATCTAGGTGGCAATTCTCGGACTGCCATGGTTGCTGCCCTGAGCCCAGCAGATATCAACTATGATGAAACTTTGAGCACTCTGAGGTATGCAGATCGTGCAAAGCAGATTAAATGCAATGCTGTTATCAATGAGGACCCCAATGCCAAGCTGGTCCGTGAACTAAAGGAGGAGGTGACGCGGCTGAAGGATCTTCTTCGTGCTCAGGGCCTGGGAGACATCATCGATACGTCCATGGGGTCCCTTACTTCATCTTCATCTTCCTGCTCACTCAATAGTCAGGTGGGCTTAACATCTGTGACCAGTATTCAGGAGAGGATCATGTCTACCCCCGGAGGAGAGGAAGCCATCGAACGTCTGAAGGAGTCTGAGAAGATCATTGCTGAGTTGAATGAAACCTGGGAAGAGAAGCTGCGTAAAACAGAGGCCATCAGAATGGAGAGAGAGGCCTTGTTGGCTGAGATGGGCGTTGCCATCCGGGAAGATGGAGGAACCCTGGGCGTTTTCTCACCTAAAAAGACCCCACATCTCGTTAACCTCAATGAGGACCCACTAATGTCGGAATGCCTGCTTTATTACATCAAGGATGGACTTACAAGGGTCGGCCAGGCGGATGCCGAGAGGCGCCAGGACATCGTGCTGAGTGGGGCGCACATTAAAGAAGAGCATTGTGTCTTCCGGAGCGAGAGGAGCGACAGCGGGGATGTTATCGTGACGCTAGAGCCCTGTGAACGCTCAGAAACCTACGTAAATGGCAAGAGGGTGGCCCAGCCTGTTCAGCTGCGTTCAGGAAACCGTATCATCATGGGTAAAAACCACGTGTTTCGTTTTAACCACCCCGAGCAAGCACGGGCTGAGCGGGAGAAGACACCCTCTGCCGAGACCCCCTCTGAGCCTGTGGACTGGACGTTTGCCCAGAGAGAGCTTCTGGAAAAACAGGGGATTGATATGAAACAGGAGATGGAGAAAAGGTTACAGGAAATGGAGATCCTGTACAAAAAGGAGAAAGAGGAAGCAGACCTTCTCCTGGAGCAGCAGAGACTGGACGCGGATTCTGATAGCGGGGATGATTCTGACAAGAGGTCCTGCGAAGAGAGCTGGAAACTGATTACTTCTTTGAGAGAAAAGCTACCTCCCAGCAAGTTGCAAACCATTGTTAAAAAATGTGGCCTCCCGAGCAGTGGGAAGAAACGGGAACCAATTAAAATGTACCAGATACCCCAAAGAAGGCGCCTCAGTAAAGATTCCAAGTGGGTCACCATCTCAGACCTTAAGATTCAGGCCGTCAAAGAGATTTGCTACGAGGTGGCGCTCAACGATTTTAGGCACAGTCGGCAGGAGATCGAAGCCTTGGCCATCGTTAAGATGAAAGAGCTTTGCGCCACGTACGGGAAGAAAGATCCCAACGAGCGGGACTCCTGGAGGGCGGTGGCCAGGGATGTCTGGGACACCGTGGGAGTAGGCGACGAGAAGATCGAAGATGTGATGGCCAGTGGTAAAGGCGGAACCGACGTGGATGACCTCAGGGTTCACATAGACAAGCTGGAAGATATTTTGCAAGAGGTCAAAAAGCAAAATAACATGAAAGACGAGGAGATAAAAGTCTTAAGAAATAAAATGCTCAAAATGGAGAAAGTCTTGCCACTGATCGGGTCGCAGGAACAGAAGACCCAAGGAAACCATAAAGCGAAGGAACCTGTCGGTGCCGGCGTCAGTAGCAAGTCTGAGAATGACGTCAGTAAAGGAGACGGTGGGGAGCTTGGGTTGTTTCCCAGCTGATGAACGGGGACCCAGCTTTCCGACGTGGACGTCTGCGCTGGATGAGGCAGGAGCAGATCCGGTTCAAGAACCTGCAGCAGCAGGAGATAACAAAGCAGCTTCGTCGGCAGAACGTGCCCCATAGGTTCATCCCTCCTGAGAACCGGAAGCCCCGCTTCCCCTTTAAGAGCAATCCTAGACACAGGAACTCTTGGAGTCCTGGCACACACATCATCATAACGGAAGACGAGGTTATAGAGCTTCGAATACCGAAGGATGAAGACGGAAGGAAAGGAAATAAAGAGGAGAGCCAAGAGAAGGGTGGTAGAGCAGCTTCTAAGGACCCCCAGTTACCATGGGGCTCTCAGGTCACCCGAAGTCAAGATCACATCCAAGTGAGCAAGCAGCACCTTAATACTCAACAACAGCCACCTCAGTTACGCTGGAGGAGCAATTCCCTCAATAACGGCCAGCAGAAGAGCGTGCGCTGCCAGGCATCTGCCTCCTCGGAGTCGTTAAACTCCCACGGAGGTCACCCCACCGCCGATCTGCAGACTTTCCAGGCCAAGCGCCATATCCATCAACACCGTCAGTCTTACTGTAATTATAACACTGGAGGTCAGTTAGAGGGCAGTGCGGCCAGTTCCTATCAGAGGCAGACTGACAAAGCCAACCACTGTAGCCAGTTTGTGACACCTCCGCGGATGAGGCGACAGTTCTCGGCACCCAATCTCAAAGCTGGTCGAGAAACCACAGTATAAATTACTGGACAAACTTGAAATCCCAGTGGAGGAAGCAGACGATGTTAGCTCCTGATTTGAGTTGGTTCTAGCCTTGGCCTTGAGTTCCTACTAATTACATCATGATTTGAATGTCGCGTTCTTACAAACATTAACTGATTTTCATACTGTCAAAACATAAAACACTGGTCAATGTTTCAACGCCTCCCTTTTGTTTGTATACCATAAATGGGCAGTTTCTGGAATTTTGGACAAAATACTGAGACCTCTCTTTTTTGCTGAGACTTTCCTCCTTTCTTGGTGCCTAGATAATATACTTACTTACAGACTGGTCTCGTTTGGTATAAGTTTGTTATGTTTTTATAACGCCTATAAGTTGATCTGATATCCAGAAAGACCTGCCTCTTGGTTTATGCACACATTCAAAAGGGGAATTGGATACATAGAAATAAATGTCTGTTGTTTCCCCATGAATGTTAGACGTTAGTTTAAAAATAATAACATGCAACTATGTGGACATAGCTTTGGATTTCTCATCCGTGTCTGTCCTTTTGAAAAAGATAATTGGACTTTTCATAAGCCAAAATGAAACGTCTTCAGACACATTTTGTAGTACACAGCTCTGCCTCTTCCACAGAACTTTACATCTTATTCTACATTTTACACAGAACTAATTTCAGTAGGATTTTTTTTCTTTTGAATGTATCAGTGTATGTATGAAATTTGTCATAATACTGAAATATT