Transcript asmbl_35669

Sequence
Transcript Sequence for observation asmbl_35669 of TGE0005109:
CCAGCCCCGATGCTCCGAACGGTTCACGCTGTTTTCCTCCCACAGTGGAGCTGGCCTGACCTTGGGGACTTTGGCTATCCTAGGAGAATCCAGTTCTCAGCCCACCAGGAGCCGAGGCAATGGCCTCAAAACCTGAGAAGCGCATCGCCTCGTCTGTCTTTATCACCCTGGCACCCCCACGTCGACACGAGGCTGTGGCTGAGGAAGTGAGGCGGGCAGCTTGTGAGGCCCGGCCCGGCCGCACCAGGGAGTCTTCCGCCCCCATGAAGGCAGCCGGGGCCGGCTCAGCAGAGAGGCCCAGTCTCTGGACGGCCCCCGGCAGGGCCGCAGCCCCGGTGCCAGCTGTGCCGCCTCAGCTCTCCAATGGAGGATGCTCTCTTCCTCCTCCAGCCCTGGATGGCGAGGACGCACTCCCCGACCTGGACCTCCTCCCACCTCCGCCGCCGCCCCCACCCGCATACCTGCCACCTTGCGATGACCAGCCTCCAGCCTCAATGGGGGCGTCACTCATTTCAGATTTAGAGCAGCTGCACCTGCCCCCGTCCCCACCACAGTCCCTGGCGGAGGGGGCTCCATTCCAGCCTCAGCCCGGTCATCTCAGGCCTGCGGAGGAGAAGTTGCCGCCTCCCCCAGCAGAGCCTGTTGGCTTGGCTGAGAGAGAGGCATCCACAGACATCTGTGCCTTCTGCCACAAGACCGTGTCCCCCCGAGAGCTGGCCGTGGAAGCCATGAAGAGGCAGTACCACGCCCAGTGCTTCACGTGCCGCACCTGTCGCCGCCAGCTGGCCGGGCAGAGCTTCTACCAGAAGGATGGGCGGCCCCTCTGCGAACCCTGCTACCAGGACACCCTGGAGAAGTGTGGCAAGTGTGGTGGGGTGGTCCAGGAACACATCATCAGGGCCCTGGGCCGGGCCTTCCACCCAGCCTGCTTCACGTGTGTGACCTGTGCCCGCTGCATCGGGGACGAGAGCTTTGCCCTGGACAACCAGAATGAGGTGTACTGCCTGGATGACTTCTATAGGAAATTTGCCCCTGTGTGCAGCATCTGTGAGAATCCCATCATCCCCCGAGATGGGAAGGATGCCTTCAAAATCGAGTGCATGGGAAGAAATTTCCATGAAAACTGCTACAGGTGTGAGGACTGCAGGATCCTCCTGTCCGTGGAGCCCACGGACCAAGGCTGCTACCCCTTGGACAACCGTCTCTTCTGCAAGCCATGCCATGTGAAGCGGAGTGCCGCAGGGTGCTGCTGAGAGCCCCACCAGGCCCTGGGGCCCTGAGCCACCCACTGGCCCTGGTCAGGAGGGGGGGATCCTCCCTGCCTCGGTTTCCCTTCCTGACCTGCTCTTGCACACTTTCCTTCCTAGCCACGAGGACCAGCCCGTCATGTCTGTGACCCCAGCTCAGGAGTGGGTGGCAGGCAGAAGGTGCCTCTCAGAATTTTGCCTCCTCCTCTCCCCTGGGCGTAGGAAGTCTTCATGCGTGAGTGTCGCACCCTAGGTGTGCGCTCTGAGCTCTGAGCCTCTGGCCCCTCTTGAGCGCTGGCCTTGACCCCATTTCCAGGGGTGAGTCGGGGCGAGTCTCTGGGAGGCACCCTGTGTCCCTAGCAATGACACTTTCATTGTCCCGTATGAGGTGCTGAGATCAGCTCTGCCTTGCAGGACTGAGCTGTTTGAGTAAAACTCCAAGGTCCCTTAAAAAGCACTTTTAAAAAAAAAGTGAGGTTTAAATGATGGGGCACATTTTTTGTATTTTTGGGGGGGTCAGTCTTAATAGGTAATGTCTTCCATGCGTTCATAAATGTACAAGAAGGTGACCTGGTTTTGGCACAGCCATGGACTTCTCAGCTGGGTGACGTGGAGCCCGGGACCAGCTGTAAACCCAAGGAGCAGAGGCAGGAGGGGAGTGCGAGGTATGGGACAGGCAAGGCAGCCTCTCCACCCTGCCCCCTGGCGCTCCTCCTGCATGCAACAGTGAGTCAACAGACATTAAGTACCTGGTGTATGCTGGGAACAAGGTGCAGGAGCTCTGAGTGTTCTTCCTGCAGCCTTGACTGGGGCCGTGCCACACCCCCAAGCCACACGCACACGCGCCCCTCCAGGACAGTCCCTCGGTTATCCCCCTAAGTTCCCACTTGGGCCCTTCTGCCCAGGCAGCCCCGTGACCACTGCCTCCTCAAGGCCACACCTAGAGGAGACGTCTTTCCTTTTAAGGAAAATCACTTTCTTTGCTTTGTAACTTCTAGACATTTTCAGGGCATGGACCAATGTCCATGCAAGATGTGCTGTCCTCCCTGCAGCCGTCTCAGTGTCCCACCCACTCCTCTGAGCATGCCCGCCTCCACAGACTGGGGGTGCTTCTCCACGGAACCCCTCAGGGGCTGCAGACCAGAGTATGGCTTCCTGCCCAAAGCTTAGAGCAGCGAGTCCCCAAACCAGGCATTCACATACCATCTACACAATTTTTGTCCTAACCAAGGACCTCCTATTCTCGTATTTCCTTAACATTGTCTTTAAACCAACATACTTTTAAAGATTCACTTCCAGCTGTAGTCTTGTGCTAAGCAATATAGCTATGCGGTCACATGTTGATGTGCTAGTTATGTTTTTTCCTATCACACATGAAAATAAATGCATAACTATTAGAAGTCCATCTGTGTTCCATCTAAGATCTCGC