Transcript asmbl_35491

Sequence
Transcript Sequence for observation asmbl_35491 of TGE0005094:
CTCTGCCTTCGCTCCTTCCGCCCAGGAAACCGGAAGTAGCCTCTCTCCCGGTGGCTCCTACGCGGTTAACGGATCCTCAGTGGACGCTGGCTGCGCGCCAAGGTAGTCAACGTGATACCTGCAGAGAGTGACTTCGGGGTTAAGGGTGGTGCTGGACGTCAGGAGCCAACATGGCAGCGGTGGTCGGAGTCTCCTTGAGGCGTCGATTCCCAGCCACAGCCTTTGGCGGAGCCTGCCTGCAGGCCTGCCGAGGGGCCCAGACAGCTGCAGCCACAGCTCCCCGAATCAAGAAATTTGCCATCTACCGATGGGACCCAGATAAGACTGGAGATAAACCTCATATGCAAACTTATGAAATTGATTTGAATAAATGTGGCCCCATGGTGTTGGATGCTTTAATCAAAATTAAGAATGAAATCGATTCTACCTTGACCTTCCGAAGATCATGCAGAGAAGGGATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACACGCTGGCTTGCACCAAAAGGATCGACACCAACCTCAACAAAGTCTCAAAAATCTACCCGCTTCCACATATGTATGTGATAAAAGATCTTGTTCCTGATTTGAGCAACTTCTATGCTCAGTACAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCCCAGGAAGGCAAGCAGCAGTATCTGCAGTCCATAGAAGAGCGCGAGAAACTGGATGGGCTCTACGAGTGCATCCTCTGCGCCTGCTGCAGCACCAGCTGCCCTAGCTACTGGTGGAATGGAGACAAGTATTTGGGGCCTGCGGTTCTTATGCAGGCCTATCGCTGGTTGATTGACTCCAGAGACGACTTCACAGAGGAGCGCCTGGCCAAGCTGCAGGACCCGTTCTCTCTGTATCGCTGCCACACCATCATGAACTGCACACAGACCTGCCCCAAGGGGCTGAATCCAGGGAAAGCTATTGCTGAAATCAAGAAAATGATGGCAACTTACAAGGAGAAGAAGGCGTCAGCTTAATTGTTCTCACACCAAACGTGACTTGCAACCAGCTCAGCTGGACATAACTTACATCTAATTTGGGTTCTTTCAGAGGTCTTCACTGTCCATGAATACAGCATGTATAATAAAACTTTTAAGAAATAAATAAATGTTATTCTACTTTATTAACAAAAAA