Transcript asmbl_35466

Sequence
Transcript Sequence for observation asmbl_35466 of TGE0005083:
CCACCATCTTTGGGCTCCTGGCCCCTACAGCGGTTAGTGGCGGCGGGAGCTGAGGAAGTAGGTGGGCCGGGTCGCGCCGCCTCCGGTGCCGGCCGTCCCTCCGTCTACCTTTCCGCCGCGGGCTCACCATGCCGCAGTATCAGACCTGGGAGGAGTTCAGTCGCGCGGCCGAGAAGCTCTACCTCGCCGACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAGTTTGTGTATTAAAGTAACAGATGATTTAGTTTGTTTGGTGTATAGAACAGACCAAGCTCAAGATGTAAAGAAGATTGAGAAATTCCACAGTCAACTAATGCGACTTATGGTAGCCAAGGAATCCCGCAGTGTTGCCATGGAAACAGACTGAATGGTTTGAAATGAAGACTGTTTGACATGTTCTTAGGAGTAAACATCTTTTGAATTTGAGGAAGTGTTGGGACAGAAAATACTTTATGTAACTAAGTGGGCTATTCAGAAGCCAAAAGATCATTTTTTTGTACATTGTTTTTTTAATGTTTCCTTTAGAGAGCTGGGAATAGAAATGATTTCGATTAGAAAGCCTTTATTTATTTTTGGAAATTGAACAAGAACTGCATCTATCTTGGGAACTTTTTGCGGATTATTTAATGCTGGGCAAAATATATAGCTATTTCTTTTGGTAAATTCGTATTGGTAATTTGAAAATGAGATGTCAAGAAAAGTCTATTCTTTAAATTTAGTTTATCCATCTTTAAAAGAAAATTAAACTCAACCATTTTACCGAATCGATAGACTTCTTTTGGAGCATAAAATTTGTATTGTTGATGACTAACAAATATAAACTATGGTAACTAGAATTAACTGCATAGCAGTATACCTAACAATATACAGTAGTATAGTCTAGATTGTATCTGAAAATAATTATGAAAACAAGTATGCTTTACCTTAAACTTTCAAAACTTAATCTATATTTTTGAGTATAAGAGTTTTATAATATTAATAGTTTGTTGAGCAGACTTACTTTGAATCTAGTTTTCAGTGCTCAAAACAACTGCAGTTCCTTTAAATGCATGAACAGAATATTCAGCGATGGACTGAAACCAGCATGTTACAGAAGTATTTGCCACACATTTCCCATCTGTAGTTTCTAAGAAGGGCTAAGGATTATGTAAATTGTTAAATTTTTGCAAAGCTCTTTGACACCCCTCCCCATTTCTCTACTTATCCAGCGGGTTAGCTTGACTGTCACACTTGTTATGTTTTCCATTAAACCAGAAGTATGATATTTAGTATTATCTATTTGTAACCTTAATTTTACCACCTAAATGTAATGTTCACTTGTCGATTCCTACATTAAAATATTTTTGGTATGGAACTTTCCATATTCCATTTTAATATGGAAAGTTCCATTAGCCATACAAATTTTGACATGTTTCAGAGAGGTCAATAAATAAAATATTATGTGGCTATATATTATTTCTCTCAAAGTTTTTAACTTCTCAAGAATCACTGATTTCTTAACTGGGATGTGCTGTATTCATGTCTAAAATGAGCTTAATGATACTGTAAATTTTGTTTTATTTTTTTGGTACTTTTATTACATGACTTTCTGTGAGCTGTATGTTAATGGCAAGGTTCTGTTCTTGGTTAAGAAAAGTAGCATCAAATAGTGTGGGACGTTTTGAGTTTCAGTTCTCTCCCCGCCCCCCCTTCCCAAAGTAGTGGAATCACTGGAGGGTTTTTTTGGCCTTTTTCTTTTCTCATTTACGTCTTCCACTTTTTAATGCTGCTTTATAAAGATAACCAGAGAGGGCTGGGCTAATTCTGGCTCGAGTCCTCAGTAGCTTGTGGGAGAGTGGTTAGAGCAGAGGTTCCAAGGCGGGCCGCCTGTGCTGCAGTCTCGGCTCCACTGCTTCCTATCACTGTGGTCTTGGAAAAGGCACTTCTGTAAGGCTCCGTGTTCCTCTGGAGATTGAGTTAACAGTAGTACTCATAGGACTTCATGAAGATTAAAGGGCATAATCCATTTTAAGCCTTTAGCACAGTGCCTGGAACATAGTAAAACTATTATTTCGGCCAACTATTGTTATTATTAGTCTTAATAGACTATAAACTCCCTTAAGTTTTCTTTTAATTTTAATTGAATAATTATTTATTGGTAATGTCTGCCTTTTCTGCCAGTCTGTGTCTATTATTAAATGCCGTTTTTGGCAGTTGAGAAATACAACAAGATTGCCCTCAGAGTGATCTTATTCGGGGGCAAATCCTTAAATCTAAAACTTGTGTTCATTCATAGCTGTATAAAGTAAAATCATTGAACTAATTGGTGGTAAAAGTATTGAATCTCTTAAAAACCATATAAATAATAAAACATCACATTCTGAAAATCGCAGTACTGGATACTCGTGATTTTTTTTTT