Transcript asmbl_35153

Sequence
Transcript Sequence for observation asmbl_35153 of TGE0005055:
AAGGAAAAAAACCCGGCAGAGGGCGGAGCTCTGCCCTTATATGGCTTGATACCGCCTCCTTCCCGCCCCCTGTGCCGCCCCCTCGGGAGCTGAATAGGCCGCGTTCCGCTTGGAACGCGCCGCAGAACCGGGGTGCTGGTGACGACCGCTGCGTTCGCTCCCTCAGTCCACTCGCCAGCCCGCTGCCCTCCACCGCTGCACCGGGCAAACCAGCCCCTCTACTCTGCCAGGTGAGCGCCCTTCGCCACGTGCGAAGGTCAGGGACCGTGGAGAAAGATCCTGTAGGCCGTGGCGGGTCGGGCGTCAGCACGGAGCCTCCCCCCATACACACACCATCACCACATACATACGCGCTCCCAGCCCAGGCTCCCCAATCCTCTCCAGTTAGAGCTCCCTCGGTTTACTGCGCAATGCGGCGGCTCTGCGCGCTGAGTCACGGCGGGGGAGGAAGCATGCGAGATGAAGGGCCATTCCCCCTCCCATTTTCTGGCTGGGACCCCTGGTGCAAAGGATACTGGCCCCGAGGCAGCGAGGGTTTGGGAGCCGACTCATATACTACCTCTGGGTTCCTGAAAGCATGTGGTTGGCCCCTACCCCGGGAGACTGGCGCCCCTGGAGAGGAGGGGAGTCTCCTTGGCAGCGCCTGATGCCCTATTAACACTTTTTTTTATCTTTCCTTATCGGATGACCTTGATTCTGAGCCTGGAACAGCTGCAGCCCTGCGAGCAGACAGGAGCCTTTTTTAGGGAAGGGGTGGGGCGCTTGCCTCTCCTCCACTCTCTTTACCCTTCATGAGCAGTGAGATCCACAGACCTCACCCCCTTCCACCTCAGGCAGGGCTTCCTCTGCTGCCCTTTCCTAGGCTTCTGATTACCTCCCACCATTTCCTTAACACCCTTTTCCAAACGCCTGACCTTGGGATGTCCTTGAGGTGTTGATGCCTGTCCCAGCTCTGGGATCTTGGGTGGATTGGAAGGGACACCTCAGTGGCAGTCAGAAGATCTGGGTTCTTATCTCAGTTCTGGCCCTTGGGTTGCTGTGTGACTTAAAGCAAAGACCTTTCCCTTCTCTCGGTCCTTTCAAATGAGGGGGTTGGGCCCTTCGCCTTATGCATGACCTCTAAATTCTAAAATACTTTGGTTCAATTTTGCTTCTAGGCAAGGTGACCCCATGGCAAGGCGCAAGCCAGAAGGGTCCAGCTTCTACATGAGCCATCTGTCCATGGCTCTGGCCTATTCCTTTACCCCAGATGCCAGTATGCAACCCCACCCTCAGCTGGGCAACACCCAGCAACAAACAGAGTTAGGAAAGGTACAAGAGGCAGGCCTAGTTTAGGGAAGTCGGGTGTAGGGGAGAGCTGGGGACAGGAAATGATCTAAGACCTACTGGGTGTGGGGCAGAGGAGGTAGGGAACATTTGCCCTGACCTCCAGGTAAGGGGCCCTGCTCACTGGGAGACCACAGAAAGACCTAGCAAACTGGTCCTCTCCGCTCTGTTTCCTTTGCCCAGGAACTGACAGGCACCATGCCCTACCAATACCCAGCGCTGACCCCGGAGCAGAAGAAAGAGCTGTCTGACATTGCTCACCGCATTGTGGCTCCGGGCAAAGGCATCTTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACTGAGAACACCGAGGAGAACCGTCGCTTCTACCGCCAGCTGCTGCTGACTGCCGATGACCGTGTGAATCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACGCTTTATCAGAAGGCAGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGTGTGGTACCCCTGGCAGGAACAAATGGCGAGACTACCACCCAAGGATTGGATGGGCTGTCTGAGCGCTGTGCTCAGTACAAGAAGGATGGAGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAGATTGGGGAACACACTCCCTCAGCCCTTGCCATCATGGAAAATGCCAATGTTTTGGCCCGTTATGCCAGCATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCACGACCTGAAGCGCTGTCAGTATGTAACTGAAAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCATCACATCTACCTGGAAGGCACCTTGCTGAAGCCTAATATGGTCACCCCAGGCCATGCCTGCACCCAGAAATTTTCTAACGAGGAGATTGCCATGGCAACTGTCACAGCGCTGCGCCGCACAGTGCCCCCTGCTGTCACTGGGATCACCTTCTTATCTGGAGGTCAGAGTGAGGAGGAGGCATCCATCAACCTCAATGCAATCAACAAGTGCCCCCTGCTGAAGCCTTGGGCCCTGACCTTTTCCTATGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGTGGAAAGAAGGAGAACCTGAAGGCTGCCCAGGAGGAATATGTCAAGCGAGCACTGGCCAACAGCCTTGCCTGCCAAGGAAAGTACACCCCAAGTGGTCAGGCCGGGGCTGCAGCCAGCCAGTCCCTCTTCATATCTAACCATGCCTACTAAGCGGAGGTGTTCCAAGGCCGCCTCAACACTCCAGGTCCTGCCCGCTTCCACACACCTGAAGAGGGGGCCTCATCCGGGGCTCCAGGCTCCTCTTTCCCATCACTCTTACCTCCCTTGTGACATTGGTGCGTGGTGTTGTCTGTGAATGCTAACTCCATCGCCCTTTCCAGCCCACTGCCAATAAACAACTATTTAAGGGGGA