Transcript asmbl_35151

Sequence
Transcript Sequence for observation asmbl_35151 of TGE0009200:
CCTGGCTGTGGTGACCCTGGTCTTCTGTCTCTAGAGAGATCTTGGTAGAAGAGAGCAACGTGCAGAGGGTGGACTCGCCAGTCACAGTATGCGGTGACATCCATGGACAATTCTATGACCTCAAGGAGCTGTTCAGAGTGGGTGGCGACGTCCCTGAGACCAACTACCTCTTCATGGGGGACTTTGTGGATCGTGGTTTCTACAGCGTTGAAACGTTCCTCCTGCTGCTGGCACTTAAGGTTCGCTATCCTGACCGAATCACCCTGATACGGGGCAACCATGAGAGCCGTCAGATCACCCAGGTCTACGGCTTCTATGATGAGTGCCTGCGCAAATATGGCTCAGTGACCGTGTGGCGCTACTGCACTGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATTGATGGCAAGATCTTCTGCGTGCACGGGGGCCTCTCCCCTTCCATCCAGACCCTGGACCAGATCCGGACAATTGACCGAAAGCAAGAGGTGCCTCACGACGGGCCCATGTGTGACCTGCTCTGGTCTGACCCTGAAGACACAACAGGCTGGGGCGTGAGCCCCCGTGGAGCTGGCTACCTATTTGGCAGTGATGTGGTGGCCCAGTTCAATGCAGCCAACGACATTGACATGATCTGTCGTGCCCACCAACTGGTGATGGAAGGTTACAAGTGGCACTTCAATGAGACTGTGCTCACTGTGTGGTCAGCACCCAACTACTGCTACCGCTGTGGGAACGTGGCAGCCATCTTGGAGCTAGATGAGCATCTCCAGAAAGATTTTATCATCTTCGAGGCCGCTCCTCAAGAGACACGGGGCATCCCCTCCAAGAAGCCCGTGGCTGACTACTTCCTGTGACCCCTTTGGCCCCTGTCCCCCTCCAGCCCCTCTGGCCCTTGGACCACTGTGACTGCCCTCTTCAGACAGAGGCTGGGCATTGGGGGGCTGTCCCCGGCTCTGCTCTCCCCACAAAGAGGGCACTTTGAGGGTGAGGACTTTCTCTGGAGAGGCTCAGAGCCTCAGCTCCATGCTCCTCCTCTCCCTTCTCCCCACTTGAACCATGAAGTTTCCAAGAATTTTTTTGGTTTTTTTTTTCCTTTTTTTGTTTGTTTTTAGATAAAAATTTTGAGAAAAAGAAAAAAATTCTAATAAAAGAAGAAAAATGG