Transcript asmbl_34216

Sequence
Transcript Sequence for observation asmbl_34216 of TGE0005027:
CTCGGCTAGCCCCGCCCGTCGACTGTTGGGCCTTTACGCTCGGACCCCGGCCCTGGCTCGGGTTCCGCGATGGGAGCTGCTCCTCGGGGGCTGAGCTTGTCAGCATCCTCCTACGGCCCTCGCCTCTGAAGTCAGAGAAGAGCCCCTACACCCACATCCCTCTTGTCCCGTTTTGGGGTCGCCTCCGTCTACCCGGTGCTTAGCCCTAGTGGCCTCCTTAGTCCGACAGAGGAGCAGGACGATGATACTGGCATCTGTGCTGGGGAGTGGCCCCCGGGGCGGGCCTCTGCTCCGTCCCTACCTGGGGCCTGCACTCTTGCTCCGGGCACGCTCCACATCAGCCACCGACACACATCATGTGGAGATGGCGCGGGAGCGCTCCAAGACCGTCACCTCCTTTTATAACCAGTCAGCCATCGACGTGGCAGCTGAGAAGCCCTCAGTCCGCCTCACTCCAACCATGATGCTCTATTCTGGCCGATCTCAAGACGGCAGCCACCTTCTGAAAAGTGCCCGGTACTTGCAGCAAGAGTTGCCAGTGAGGATTGCTCACCGCATCAAGGACTTCCGCAGCCTTCCTTTCATCATTGGCTGCAACCCCACCATACTGCACGTGCATGAGCTGTACATCTGTGCCTTCCAGAAGCTGACAGACTTCCCTTCGATCAAAGACCAGGCGGATGATGCCCAATACTGTCAGCTGGTGCGTCAGCTGCTGGACGACCACAAAGATGTGGTGACCCTCTTAGCTGAGGGCCTACGTGAGAGCCGGAAGCACATACAGGATGAGAAGCTTGTCCGCTACTTCTTGGACAAGACACTAACTTCAAGGCTTGGGATCCGCATGTTGGCCACACATCATCTGGCACTGCATGAGGACAAGTCTGACTTTGTTGGCATCATCTGCGCTCGTCTCTCACCAAAGAAGATTATTGAAAAGTGGGTGGACTTTGCCAGACGCCTGTGTGAGCACAAGTATGGCAATGCCCCCCGTGTCCGCATCAATGGACATGTAGCTGCTCGATTCCCCTTCATTCCAATGCCACTGGACTACATCCTGCCCGAGTTGCTCAAGAATGCCATGAGAGCCACGATGGAGAGTCACCTAGACACTCCCTACAATGTACCAGATGTGGTTATCACCATCGCCAACAATGATATCGATCTTGTCATCAGGATTTCAGACCGGGGTGGGGGAATTGCTCACAAAGACCTGGATCGTGTTATGGACTACCACTTCACTACAGCTGAGTCCAGCACCCAGGACCCCCGGATCAACCCACTCTTTGGCCACTTGGACATGCACAATGGTGGCCAGTCAGGACCCATGCATGGCTTTGGCTTCGGGCTGCCCACCTCACGGGCCTATGCGGAGTACCTTGGTGGTTCCCTTCAGCTGCAGTCCCTGCAGGGCATTGGCACAGATGTCTACCTGCGACTCCGTCACATCGATGGCCGGGAAGAAAGCTTCCGCATCTGATCCCACAGTCCTTGACCCTGCCCATCCCAGGCCACACACCCTGCTCCACACACTGCTGCATCTTGGGTCCTAGGACCCCAAATGGATGGACTTACATGGAGCCAGCGCCACCTCTCAACGGGGTCCACTGCTTACCTGCCTCCAGGCCTTGGTGGGGAAGTGGGGACACTTGAGGTCTCCAGCACCAGCTCCTTCCTCGTTCCTGAGGAACCCCATTTTGACCTGCTGTTTGTTAATTAAAGTTCACATTTTGAA