Transcript asmbl_13653

Sequence
Transcript Sequence for observation asmbl_13653 of TGE0000192:
GACTTTGCTGGAAGAGGGATTAACCCATAGCCCTTCCAATGCTCAGTTCAAATTGCTGCTTGTTCGAATCTACTGTATGCTGGGTGCATTTGAACCAGTGGTGGATCTTTACTCCAGCCTCGATGCTAAGCATATCCAGCATGATACCATTGGTTATCTTTTGACCCGATATGCTGAATCTCTAGGTCAGTATGCTGCTGCGTCCCAATCCTGTAACTTCGCACTCAGGTTTTTTCACTCCAACCAGAAAGATACCTCAGAATATATTATTCAAGCTTACAAATATGGTGCATTTGAGAAGATCCCAGAGTTTATCGCTTTTAGGAACAGGCTGAATAATTCTCTTCATTTTGCACAAGTCCGTACTGAACGGATGCTGTTAGACCTTCTACTTGAAGCAAATATATCAACCAGTTTAGCAGAAAGTATAAAGTCAATGAACCTTAGGCCAGAAGAAGATGACATTCCATGGGAAGATTTGCGAGACAACAGAGACTTAAATGTTTTTTTCAGCTGGGATCCAAAAGACAGGGACGTTTCTGAAGAACATAAGAAACTTTCCTTAGAGGAGGAGACCTTGTGGTTAAGAATCCGATCCTTAACATTGAGGCTGATAAGTGGACTTCCAAGTCTCAACCACCCTGTGGAGCCAAAGAACTCGGAGAAGACTGCCGAGAATGGGGTATCCTCCCGGATTGATATTCTTCGTTTGCTCCTTCAACAGCTGGAGGCAACCCTGGAGACAGGAAAGCGATTTATTGAGAAGGATATTCAGTATCCTTTCCTTGGTCCTGTACCTACCAGAATGGGTGGATTCTTTAATTCTGGCTGTTCTCAGTGCCAGATAAGCTCTTTTTATCTTGTCAATGATATTTATGAGCTGGATACCAGTGGTTTAGAGGATACAATGGAGATTCAGGAACGAATAGAAAATAGTTTTAAGTCTTTACTAGACCAGTTAAAAGATGTCTTCAGTAAATGTAAAGGTGACCTCTTAGAAGTTAAAGATGGTAACTTGAAAACACATCC