Transcript asmbl_34040

Sequence
Transcript Sequence for observation asmbl_34040 of TGE0005013:
CTTTATGCAGCGCCGGCCTTGGCGGGAGGGAATCCTTGGACATCGGGCTGTACCCCTGAGCTGGCGTGCCCCCAATCTCGGGGGGTTAGTTCCAGTCCGGGCGGCAGCAGATGCCAGGATCTCACTAACTGGCTGGTTTTTTTCGCTCTCTTCAGCAAATGGCGGATGACGCCGGTGCTGCGGGAGGGCCCGGAGGCCCCGGGGGCCCTGGGATTGGAGGCCGCGGCGGCTTCCGTGGAGGATTCGGCAGCGGCATCCGGGGTCGAGGTCGTGGCCGGGGTCGCGGCCGGGGCCGAGGCCGCGGAGCTCGCGGAGGCAAAGCTGAGGATAAGGAGTGGATTCCCGTCACTAAGTTGGGCCGCTTGGTCAAGGACATGAAGATCAAGTCTCTGGAGGAGATCTATCTCTTCTCCCTGCCAATCAAGGAATCTGAGATCATTGACTTTTTCTTGGGAGCATCTCTCAAAGACGAGGTTTTGAAGATTATGCCCGTGCAAAAGCAGACCCGTGCTGGTCAGAGGACCCGGTTCAAGGTATCCCAGCTATCTTGTCTTAATGGGCTATTTCTGCCAAGGGGCTTTGTAAGACTCTCCCAGCTCTGCATAGTTACACTTGTTTTCATACGTGTAACTTTCGTAATGGGGAGAGAGAGAAAGGATCTCCTCAAGATCTCAGATTGGTCTCATTGTGGCCTCTCCTTCCTTGAGGGGCACAACAAGCCCTGGGCAGTGTTTACTGATAATTGTGTAAGCTAGTGGACCACCAGCCACTTCAGTCTCTTCACAGGCATTTGTTGCCATTGGGGACTACAATGGACATGTCGGTTTGGGTGTCAAGTGCTCCAAGGAGGTAGCCACTGCCATCCGTGGGGCTATCATCCTGGCCAAGCTCTCCATTGTCCCTGTGCGGCGAGGCTACTGGGGGAACAAGATCGGCAAGCCCCACACCGTCCCTTGCAAGGTGACTGGCCGCTGTGGCTCTGTACTGGTGCGCCTCATCCCTGCCCCCAGGGGCACTGGCATTGTCTCAGCCCCTGTGCCCAAGAAGCTGTTGATGATGGCAGGTATTGATGACTGCTACACCTCAGCCAGGGGCTGCACTGCCACCCTGGGTAACTTTGCCAAGGCCACATTTGATGCCATCTCTAAGACCTACAGCTATCTCACCCCTGACCTCTGGAAAGAGACCGTGTTCACCAAGTCTCCCTATCAGGAATTCACTGACCATCTTGTAAAGACCCACACTAGAGTTTCTGTGCAGAGGACCCAGGCTCCAGCAGTGGCTACCACATAATTTTATACAAGAGAAATAAAGTGAATTAAATCTGTTAA