Transcript asmbl_4138

Sequence
Transcript Sequence for observation asmbl_4138 of TGE0001954:
GAGGGCGGGCTAAAGAGGTCGCGGTCGCACGCGCAGTTGGTCCTTAGTACTGCGGCCGTGTGGGTGAGTTGGCTGCCGGTGAGTTGGGTGCCGGTGGAGTCGTGTTGGTCCTCAGAATCCCCGCGTAGCCGCTGCCTCCTCCTACCCTCGCCATGTTTCTTACCCGGTCTGAGTACGACAGGGGCGTGAATACTTTTTCTCCCGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGGATCCAGACATCAGAGGGTGTGTGCCTAGCTGTGGAGAAGAGAATTACTTCCCCACTGATGGAGCCCAGCAGCATTGAGAAAATTGTAGAGATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTAATTGCTGATGCTAAGACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTACAATGAGACAATGACAGTGGAGAGTGTGACCCAAGCTGTGTCCAATCTGGCTTTGCAGTTTGGAGAAGAAGATGCAGATCCAGGTGCCATGTCTCGTCCCTTTGGAGTAGCATTATTATTTGGAGGAGTTGATGAGAAAGGACCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCAGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCACAAGTCTATGACTTTGAAAGAAGCCATCAAGTCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAGCTGAATGCAACAAACATTGAGCTAGCCACAGTGCAGCCTGGCCAGAATTTCCACATGTTCACAAAGGAAGAACTTGAAGAGGTTATCAAGGACATTTAAGGAATCCTGATCCTCAGAACTTCTCTGGGACAATTTCAGTTCTAATAATGTCCTTAAATTTTATTTCCAGCTCCTGTTCCTTGGAAAATCTCCATTGTATGTGCATTTTTTAAATGATGTCTGTACATAAAGGCAGTTCTGAAATAAAGAAAATTTTAAAATA