Transcript asmbl_13639

Sequence
Transcript Sequence for observation asmbl_13639 of TGE0000191:
GGCCGCTGCACTCCCCGCGCGCATCCGTGCGCCGCCCGAGGCTGTCTAAGGAGTCGGCGGCCATTTTGTTCTTCTCGTGGTTCCAGTGGGGAGAGAAGGAGGAAGTAGGGAGCGGGGTGGCAGGGGGGGGACCCGCCGCGGCTGCTGCCACCGCCGCCACCACCGCCTCTGCTCGTGGCGTGGGAAAGGAGGTGTGAGTCCCGGGCGCGAGCCGGCGGCGGCGCCGCTGCGGGAGGGTCGGCGGTGGGAAGGCGATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATACTATGATTTGCTGCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCTGAGAATTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGATGAATGTAAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCGATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCCAAGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCGTTTTGACACTGCCTAGTCGGGACTTGTAACATAGAGTATATAACCTTCATTTTTAAGACTGTAATGTGTACTGGTCAGCTTGCTCAGATAGATCTGTGTTTGTGGGGGCCCTTCCTTCCATTTTTGATTTAGTGAATGGCATTTGCTGGTTATAACAGCAAATGAAAGACTCTTCACTCCAAAAAGAAAAGTGTTTTGTTTTTTAATTCTCTGTTCCTTTTGCAAACAATTTTAATGATGGTGTTAAAGCTGTACACCCCAGGACAGTTTATCCTGTCTGAGGAGTAAGTGTACAATTGATCTTTTTTAATTCAGTACAACCCATAATCATGTAAATGCTCATTTTCTTTAGGACATAAAGAGAGCCCTAGGGTGCTCTGAATCTGTACATGTTCTTGTCATAAAATGCATACTGTTGATACAAACCACTGTGAACATTTTTTATTTGAGAATTTTGTTTCAAAGGGATTGCTTTTTCCTCTCATTGTCTTGTTATGTACAAACTAGTTTTTATAGCTATCAACATTAGGAGTAACTTTCAACCTTGCCAGCATCACTGGTATGATGTATATTTAATTAAAGCACACTTTTCCCCGACCGTATACTTAAAATGACAAAGCCATTCTTTTAAATATTTGTGACTCTTTCCTAAAGCCAAAGTTTCTGTTGAATTATGTTTTGACACACCCCTAAGTACAAGGTGGTATGGTTGTATACACATGCTGCCTTCTTGGGGATTCAAAAACAGGTTTTTGATTTTGAATAGCAATTAGTGATATAGTGCTGTTTAAGCTACTAACGATAAAAGGTAATAACATTTTATACAATTTCCATATAGTCTATTCATTAAGTAATCTTTTTACAGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGACCGATTATGCTTTCTTTGGCCTACATTCTTTATTCTGCGGTGAAGTTGAGGCTTATAAGTTAAAACAAAGGAACTAACTTACTGTCCACCAGTTTATACAGAACTCACAGTACCTATGACTTTTTTAAACTAAGATCTGTTAAAAAAGAAATCTGTTTCAACAGATGACCGTGTACAATACCGTGTGGTGAAAATGAATTCAGACTTATTAAATGATGAACTTGTTAAATCTTCTCAGTGTCTATTTATCAGCACAATACACACAGGAGAACTGTTGATGGCATATTGAATAGATTTTCCTGAATAAATTGCTCTGGAAACC