Transcript asmbl_32819

Sequence
Transcript Sequence for observation asmbl_32819 of TGE0004925:
CTGGCTCTTTTCTCTCTGGCCTGTCCCCGCCTCCTCCAGTGCCTCCACTCCCCGCTACCCAGGAAGGCCGTGTGGGTTACGCGCGCTGCTTTCGCTTTCCCTTGGCGGTGCCCACTCCTCGCTCCTCGTGAGGCGCTAGGCCCCCTGCCCCTGCCATGGCCATGCTCAGGGTCCAGCCTGAAGCCCAAGCCAAGGTCGATGTGTTCCGTGAAGACCTGTGTACCAAGACAGAGAACCTGCTCGGAAGCTATTTCCCCAAGAAGATTTCTGAGTTGGATGCATTTTTAAAGGAGCCAGCACTCAATGAAGCCAGCCTGAGCAATCTGAAAGCCCCATTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAAAAAAGGGGAAGACGAAGACAAAGGTCCTCCCTGTGGCCCAGTGAACTGCAATGAGAAGATTGTGATCCTTCTACAGCGCCTAAAGCCTGAAATCAAGGATGTCATTGAGCAACTTAACCTCGTCACCACCTGGTTGCAGCTGCAGATCCCTCGGATTGAGGATGGAAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATGACCGCCCTTCACACCAAGCTGGAAGGCTTTCACACTCAAATCTCCAAGTATTTCTCTGAGCGGGGTGATGCCGTGACCAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTGGTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGAAATGCTTATGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTGAGAGCCTTTTCTCATACTGTGATGGGTCCAGCAGAGACCTTCCTATCTTCGACAGGGCACTCCAAACTTTGTCCCACCTTCCACCTATTGAGTTCTCTTCCCCTCCCCAACCCCCTTGCCTCCTAGGCACAATAAATAGAGTCCTAGTGGTACCCAA