Transcript asmbl_32802

Sequence
Transcript Sequence for observation asmbl_32802 of TGE0004922:
GGAGGTGGAGGAGGAGGAGGATGGGAAGAAAGGTTCCTTGGAGACCCTGGAGGAGCTGGTCCAAGGACTAGCCTCTGAGGTGTGTGATGATTTTCTTTTCTACTGTGGAGACACACATAGCAGCTTCGTGGTCAGAACTCTGCTGCAGGTGTTAGGAGGGACTCTTCTGGAGTCTGAGAGAGCCAGACACCGTGGCTCCCAGTCACCTGAAACACAAAGGGCCCCACCTCGAGAATGTAAACCAACTGATTTTGAGGTTCCTGAATCCTTCTTGAATTGCCTTCAGGACCTGAGCTCCTGCTTTCTGAAGGATATTGCTGTGTTTATCACTGACAAGATCTCCAGCTTCTGCCTTCAAGTGGCCTTACAGATCTTACACCGCAAACTTCCCCAGTTTTGTGCCCACCTCTGTAATGCTGTGATTTGCTACCTGAGTAACCGCAATTCCTCAGCAGATGGCAGCCCCCTACTGCTATTTCTGCGGGATCAGACGAGCTCCAGACTCCTGGAGCAGGTGCTGCTGGTGTTGGAGCCTCCGAAGCTCTGGAGCCTCTTTGAGGATCACTTCCAAGGGCAGCTGCAGATCCTCGCTGCACATCCTATTGCCAACTTCCCTTTGCAGCGTTTACTGGATGCTATCACTACACCTGAGCTACTGTCCTCCGTGTTTGAGGAGCTGAGCCCTGCCTTGGAAGCTGTGCTGGCCCAGGGTCACCCAGGGGTAGTTGTTGCCCTGGTGGGGGCCTGCCGCAGAGTTGGAACCCACCAAGTCCAGGTCCTGCAGCTGTTGTTAGAGGCATTCCACTGTGCAGAGCCCTCTTCCCGGCAAGTGGCCTGCGTGCCTCTCTTTGCCACTTTGATGGCTTACGAGGTGTACTATGGACTAGTAGAGGAGGAGGGGACAGTGCCTGCAGAGCACCAGGTTGAAATGGCCACAGCCAGGGCCCTAGGGGAAGTGTCAGTCCTTGGGTCTCTACTGCTCCAGCATCTATTACATTTCTCTGCTCCTGGCCTTATACTTCGAAGTCTGGGTGCCTTGACAGGACCACAACTTCTGACTCTGGCCCAAAGCCCTTCTGGTTCCCATGTGCTTGATGCCATCCTGACCAGTCCCTCCGTGACGCACAAGCAGCGCCGCCGTGTGCTGAAGACCCTAAAGGGACAATATGTGGCTCTGGCTTGCAGTCGCCATGGCAGCCGTGTGCTAGATGTCATCTGGGGTGGAGCAGCCTTGGGGGCCCGGAAGGAAATTGCTGCTGAGCTGGGGGAGCGGAACCAGGAGCTGATAAAAGATCCTTTTGGCCACCACGTGGCTCGAAATGTGGCCCTGACTACCTTCTTGAAGCGACGAGAAGCTTGGGAACAGCAGCAGGGGGCGGTGGCCAAGCGGAGGCGGATTTTGAACTCAATACTTGAGGACTGAGGCCTTGGGATCCGGGACTGGGTGTTGATGGGGGAG