Transcript asmbl_31377

Sequence
Transcript Sequence for observation asmbl_31377 of TGE0004845:
GCGGGGTTTAAATCTGAGGCAAGGCCCTGCATCTCCCAGCGTGCTGCAGAGGAACGGCTGTTGATCTGTGTTGAATTCAGGTCCCCGGCTTGTCGGGGGCTCGAGTTCTCGGCTTCTCTCCTCTGAGCTGCTACCTGTTGAAGAGGAAGCCATGGCGTTCCGGGTCACCAGGAACACGAAAATTAATGCTGAAAATAAGGTGAAGATCAATATGGCAGGCGCAAAGCGCGTGCCTGTGTCCACTGCTGCAGCCTCCAAGCCGGGCCTGAGACCAAGAACCGCCCTTGGAGACATCGGTAACAAAGTCAGTGAACAGCCACAGGCCAAATTACCTCTGAAAAAGGAAGCAAAAACTTTAGCTGCTGGAAAAGTTATTGCTAAAAAAGTACCTAAACCTCTGGAAAAGGCACTGGAGCCTGTGCCTGAGCCTGCGCAGGAGCCTGTGCCGGAGCCTGCATCAGAGCCAGAACCTGAGTCTGTTAACAAAGAAGAAAAACTTTCTCCTGAGCCTATTGTGGTTGATACTCCCTCTCCAAGCCCAATGGAAACGTCTGGATGTGCCCCTGCAGAAGAATATCTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTGAACGATGTGGATGCAGAAGATGGAGCTGATCCAAACCTTTGTAGTGAATATGTAAAAGATATCTATGCTTATCTGAGGCAACTTGAGGAAGAGCAAGCAGTCAGACCAAAATACTTACTGGGTCGTGAAGTCACTGGAAACATGAGAGCCATCCTAATTGATTGGCTAGTGCAAGTTCAAATGAAATTCAGATTACTGCAGGAGACCATGTACATGACTGTTTCCATTATTGATCGGTTCATGCAGAATAATTGTGTTCCCAAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAAATGTACCCTCCAGAAATCGGTGACTTTGCTTTTGTGACTGACAACACTTACACTAAGCTCCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAATTTTAGTCTGGGTCGCCCTCTACCCCTGCATTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTGGAGCAACATACTTTGGCCAAATACTTGATGGAACTAACGATGTTGGACTATGATATGGTGCACTTTTCTCCTTCTCAGATCGCAGCGGGAGCTTTTTGTTTAGCACTGAAAATTCTCGATAATGGTGAATGGACACTAACTCTACAGCATTACCTGTCATATACTGAAGAATCCCTTCTTCTTGTTATGCAACACCTGGCTAAGAATATAGTCATGGTGAATCGTGGACTTACAAAGCACATGACTATCAAGAACAAGTATGCCACAGCTAAGCATGCTAAGATCAGCACTCTTGCACAGCTGAATTCTGCACTAGTTCAAGATCTGGCCAAGGCTGTGGCAAAAGTGTAACTTGTGAAATTGAGTTGGAGTACTGTAATGATCTGCAAATAAAATTGGCACCATGTGCTATCTGTATATATTACATGTTACATTTATTTACTTTTAATAAAGTTGTGGACCTTTTTACTTCTTACCTTAACTCATTTGAATGTGGCCACTTCCTGCTCTTGGGGAACCCTAAAAGTAGCCTTAAAGATATGCTAGGGAATATAGAGTATTAAAAAAAGCGCTTTCAGTTAAACTAGGGACCCAACTAATATATATAATTGTTGCTTATATGATTCTTGTTTTATATACCTACCTGGATTTTGCTTTATAAATAGGAATTACTAAGGTTATGAAGGCATTTAAAACCCTTACCTTCCATAGGGCATACTGCATGTAAGCCTAGTCATCTTGGAGCATCTGCTGCCTTGTTCTACTTAAGTAAAAGTCTGCCACCTCATCCCTAGTCCGCCATTTTCTGTTTCTTCTGGTGTTTGCTGCCATAAATTCTAAGTAATCTACTTTTACCACTATTTCTTAAATTATCAACTTTAGTATCAACTTTTTCACTTGGAAAAATGACTTTATATTCTAAACATACTTTACTTTTTCTTTATTAGTTGAGAAAATAAAACAGACTCCTCAAAACATACCAAAGTATCTTAAAAAGTTTATTTTACCTCTCCCCGCAACTCTCCTACATCTCCACGCCCTCGACCTGAAGATGTCAACAGTTTGAGATGTAGCCTTCCATGACTTCTATAAACATAGATGTGCATAGATATAAATTGTCATGGAGATTTTAAAACATAAGATTTTTCTACATGCTTAGCAATTCCTTTCAATATGTATAGACATCTGTTTTAGGGTATTACGTTCCAGAGTATAATGTATTCAGTCATTCAATTGACATTTGGATGGCTTTTTTCTTTGCCCCTAAAGACAATGCTGTTTAAATATCATTAAGTATCATGTTGGTTTTTTGGGGGTTTTTTTTACATAAATTGGGTTCTCCAAAGGGTATGTGTGTTCTCACTTAAAGCAGGTCCTGTCAAATGACTTTCTCAGTGTCATCAGCAATGTACAAAAGTGCTGGTTTTCTCTGCAGTTTTGTCAAAACTAAAGATAATCTCTTTAATTTCTGTGAATTTGGGAATTCTACCTTGTTTGCTGTTTTAATGTATACTCCTAATGATTACTTGAATAAATTTTTGTTGTCTACTAACTTTTCAATGTGTAAGCCTTTCCCAGTTTGTTATTTGCCCTTTGACTATTAATGCT