Transcript asmbl_30340

Sequence
Transcript Sequence for observation asmbl_30340 of TGE0004785:
GGAGTGGATCTGCTGCTCTGGCTACGGGAGAGTGACCCTGTGAGCATTGGGTCTTGTCGTGGCGATGGCCTCGTTCGTGACAGAAGTTCTGGCACACACGGGGAGTCTGGAGAAGGAGGATCTGGGCACTCGGATCAGCCATCTGACTCGGCGGGTGGAGGAAATCAAGGGTGAGGTGTGCAGTATGATCAGCAAGAAGTACAGTGAATTCTTGCCTAGCATGCAAAGTGCACAGGACCTTGTTACACAAGTGGACAAGCTATCTGATGACATTGACCAGCTGAAATCCAGGATAGAGAGTGAGGTCCGCCGGGATCTTCATGTATCAACCACTGAATTTACAGACTTGAAACAGCAATTGGAAAGAGACTCGGTAGTCCTCAGTTTGCTTAAACAGCTACAAGAGTTTTCTACTGCTATTGAAGAATATAATTGTGCATTAGCAGAGAAGAAGTATGTCACTGCTGCTCACCGTCTAGAAGAGGCACAGAACTGCTTGAAGTTATTAAAATCCAGAAAATGCTTTGATTTAAAAATGTCGAAATCTCTCAGCATGGAGCTTACGATACAGAAACAGAACATACTGTATCACCTTGGAGAGGAGTGGCAGAAGCTGATTATATGGAAGTTCCCACCATCAAAAGATATGAGCAACTTGGAATCTTGTCTACAAACAGAACTTCATTTATACACTGAACAGTCTCAAAACGAAGAGAAGACCCCTGTGCCACCAACCAGTTCTGTCCTCTTGGCATTTTCTATTCTAGGAGAGCTACATACCAAGCTTAAATCATTTGGTCAGATGCTGCTGAAGTATATTCTTAGGCCTTTGGCAACTTGCCCCTCCCTTTTTGCTGTGATAGAAAGGCAGCCTAACATCATTATTATTCGTTTTGAATCTGTGATGACTGACTTGGAACATCCATCACCATCTGAAGTTTTTGCGAAGATCAGACTGGTGTTGGAAGTGCTGCAGAAACAACTAGATTTCCCTCTTGATGCTGATCTAGAAAATGAAAAAACATCTAAGATCATATTGGCTGAGATGCTTGGTGACACGATCTGGGAAGACTTGTCTGAGTGCCTCATTAAAAACTGTTTGGTTTATTCTATCCCAACAAATAGCAGCAAGTTACAGCAGTATGAGGAGATCATACAATCCACTGAAGAATTTGAAAATGCCTTAAAGGAGATGAGGTTTTTAAAAGGAGATACTACTGATTTGCTGAAATATGCCCGTAACATCAATTCTCATTTTGCTAACAAGAAATGTCAGGATGTGATTGTGGCAGCTAGAAATCTAATGACCTCTGAAATTCACAACACTGTGAAGATTACTCCTGATTCTAAGATAAGTGTACCTGACTTACCCAGCCCTGATGTGGATGACAAGCTACAAGTACAGAAAATGTCCATAACTCAGTACAGTGAAGTGGTGAATTTAGAGCCTGAAAATACATTGGACCAACATTCCTTTTCTTTGCCCACATGTCGTGTCAGTGAATCTGCGAAGAAATTAATGGAACTTGCCTATCAGACTTTACTAGAGGCGACAACCAGCAGTGATCAGTGTGCTGTTCAACTTTTCTACTCAGTAAGGAATATCTTCCATTTATTCCATGATGTCGTACCAACATATCATAAGGAGAACCTTCAAAAACTGCCCCAGTTGGCTGCCATTCACCATAACAACTGTATGTATATTGCTCATCACTTGCTGACCCTGGGACATCAGTTCAGATTTCGTCTTGCTCCCATTCTTTGTGATGGCACTACTACTTTCGTGGATCTTGTACCTGGCTTTAGGAGACTTGGGACAGAGTGTTTTTTGGCCCAAATGCGAGCACAGAAAAGAGAACTTCTGGAAAGATTATCAAGTGCTAGGAACTTTTCAAACATGGATGATGAAGAGAACTATTCTGCAGCAAGTAAAGCAGTCCGTCAGGTACTGCACCAACTAAAGAGACTTGGAATTGTGTGGCAGGATGTCCTGCCCGTGAATATATATTGCAAGGCTATGGGGACTTTACTCAATACTGCAATTTCTGAGATCATTGGCAGAATCACTGCCCTAGAGGACATCTCTACTGAAGATGGTGATAGATTGTATTCCTTATGCAAAACAGTGATGGATGAAGGACCTCAAGTATTTGCACCTCTATCTCAGGAAAGCAAGAACAAGAAATATCAAGAAGAGGTTCCAGTCTATGTGCCAAAATGGATGCCATTTAAAGAATTAATGATGGTGTTACAGGCCAGCCTGCAAGAAATTGGGGATCGGTGGGCAGATGGAAAAGGGCCCTTGGCAGCTGCATTCTCTTCCAGTGAAGTAAAAGCTTTAATTCGTGCCTTGTTCCAGAACACAGAAAGAAGAGCAGCTGCCCTTGCTAAGATTAAATAGCTCCACCTTCCCGAGAAAGCCATGTCTTTACTATGGATTTCTCTCTTGGCATAATTACTCATTTAGAGACTTCTTAGAGTCACCCACTGGTTTTGGTGAACCAATATATCATGGAAGTTTTATTTCACCTAAGAACGCCTTACCTCTTGGCTTGTAGGAGGCCATGTTGAATAACTGGATGTTAAGATGTCAAGTGAAGCACCTTACTTTGTTGAATTTCTAGCCACCCTTCTTAGATAAGAAACTGTAGAGCAGCATTGTTTTATGTTACTTCTAGGGCCTTCTGGGAACCATATCCATTGTAAATGTAGGCCCTGGCCTCGGATCAAGGAATCCAGGAGATTCCAGGAGTCAGGGTAAAGAATTTGTGAGCAAACAGGAGATATATTTTGGGGGGTAGGGGAACCATATTTGGCTTTGCAGAAATTAAGAAGACTTCCTTTAAGATTTTTTCCAATAAATAATGCTTTT