Transcript asmbl_13635

Sequence
Transcript Sequence for observation asmbl_13635 of TGE0000189:
AGGGTCCGTGCGGGCCTCCGTACGGCAATTTCTGTCTCCCTCTGCTCTCATTGGTTGCGGTTAAGTGGGCGGGTCGCCGAGGAGCCTGAGGAAGAGGGCGGCGACGGTGGTGGTGACTGAGCGGAGCCCGGTGACAGGATGGCTGGGCACAGATTGGTGTTGGTATTAGGAGATCTGCACATCCCACACCGGTGCAACAGTTTGCCAGCTAAATTCAAAAAACTCCTGGTGCCAGGAAAAATTCAGCACATTCTCTGCACAGGAAACCTTTGCACCAAAGAGAGTTATGACTATCTCAAGACTCTGGCTGGTGATGTTCATATTGTGAGAGGAGACTTCGATGAGAATCTGAATTATCCAGAACAGAAAGTTGTGACTGTTGGACAGTTCAAAATTGGTCTGATCCATGGACATCAAGTTATTCCATGGGGAGATATGGCCAGCTTAGCCCTGTTGCAGAGGCAATTTGATGTGGACATTCTTATCTCGGGACACACACACAAATTTGAAGCATTTGAGCATGAAAATAAATTCTACATTAATCCAGGTTCTGCCACTGGGGCATATAATGCCTTGGAAACAAACATTATTCCATCATTTGTGTTGATGGATATCCAGGCTTCTACAGTGGTCACCTATGTGTATCAGCTAATTGGAGATGATGTGAAAGTAGAACGAATCGAATACAAAAAACCTTAAAGCCAGGCCTGTCTTGATGATTTTTGGTTTTTTTTCATTGTCCTGTTGAAATCAAGTAATTAAACATTTAAGAGCCACAAAATTGTATCACTTTTATAATATTTTGCAGTAAAATATAATACCATCTTCTCTGTTAATACATAATTGCTCCAAGCTTCCTGTAAACTATAAGAATATATTTAGTTTACAGTATATGGATTCTATGAAAAAATGTCCACAACACAGTAATTGGTCACTTGTTAAGAAAAATTTATCCTTGTAAGTATCTTCAAAGTTGATATTTGGAACTTTATTCCAAAAGTAGTGCATGTGGAGAAAGAATCTAGACTTTCTTGTATACATTTTTCTCTTCTCCAGTAATAAACAATTACCTTTCATTTATACTTTGATAACCTGTATTTAATTTAAAAAAAAACATAAAAATGAGGAACCAAGTGAAACTACGGATATAAATATTAAAGTGGACGAGATGACCTTTCAGAGCTCTTCTCTTACATTGTGTCATAATGTTGGACTCAGATTTTATTTGCTAAATAATATACCATGC