Transcript asmbl_29860

Sequence
Transcript Sequence for observation asmbl_29860 of TGE0004737:
GGGCAAGTTATTTTCTGCTATCCACCCTAGCTGGAATTTATGCCAGCCTTGGGGGCTTTCTGCTCCCTCCTCCAGTGAGGAAGAGTCTCAGAAGCCCCTCTAATGCAGGTTAAAGAGGTTCAGTCTAGCTAAGGTCAGCTCCCTAGGGCCTCCGCAGTCTGTCTCCTGGGTTAAGAGCTGGCTTTGCAAGAAAAATCTGTGAAGCCTGAGATGCAAGGTTATTAACCCCATTTTCAGCTCTTCATGGCGGGGCTTGGAAGAGGCGGGCTCCCAGGGAAAAGCCAGTGTCCTCCCCAGCCTAAGGCCGCGGCGACCGAGCCAGGCGAAGGGACCGGGGTACCCCTCACCCTCCAGGAGCTCTAGAGACCCAGGACCATGGACAATTTCAATAGGAACCAGGTAGGCCCTGGATGCAAGACCCAAGTAATGGTGCAGAAAGGACCATTGGACCTGATTGAGACAGGCAAAGGGCTGAAAGTACAAACAGACAAACCCCATCTGGTGAGCCTGGGCAGTGGGCGACTCAGCACAGCTATCACCTTTCTGCCGCTGGAAGAAGGGAGGACAGTGATTGGCTCTGCAGCCAAGGACATCTCACTGCAGGGTCCAGGCCTGGCTCCAGAGCACTGCTACATCGAGAACCTGCGGGGCACCCTCACCCTCTACCCTTGTGGTAATGCCTGTGCTATTGATGGACTCCCTGTTCGACAGCCCACCCGGCTCACTCAGGGCTGTATGTTGTGCCTGGGTCAATCTACCTTCCTCCGCTTTAACCACCCGGCTGAAGCCAAGTGGATGAAAAGCATGATTCCTGCCGGGGGCCGTACTCCTGGGTCTCCGTACAGTCCTGGCCCAGAATCAGAAAGCCTGGTGAATGGGAACCATACCCCACAGCCTGCAACTCGGGGACCCTCTGCCTGTGCCAGCCACAGTTCCCTGGTGAGCTCAATTGAGAAGGACCTGCAAGAAATCATGGATTCACTGGTGCTAGAGGAACCTGGAGCTGCTGGCAAGAAGCCTGCCACAACTTCCCCACTGTCGCCGATGACTAATGGTGGTCGTTACCTGCTGTCCCCCCCAACCAGCCCTGGTGCCATGTCTGTGGGTTCCAGCTATGAGAACACCTCTCCAGCCTTCTCTCCACTCTCCTCACCAGCCAGCAGTGGAAGCTGTGCCAGCCACTCACCCAGTGGGCAGGAGCCAGCATCTTCCACACCCCCACTAGTGCCTGCCCGTTCCTCTAGCTACCATCTGGCCCTGCAGCCCCCACAGTCCCGACCTAGTGGTGCCCGCTCCTCTGAGAGCCCCCGGCTGGGCAGGAAAGGGGTTCATGAGAGGCCTCCCAGCCCTGGCCTCCGGGGTCTGCTGACAGACAGCCCTGCATCTACTGTCTTGGCGGAGGCCCGCAGAACCACTGAGAGCCCCCGGCTATGTGGGCAGCTGCCTCTGGTGGCTATCAATCTGAGTGAATACTCGGCTTCTGGTGCCCACAGTCAACCCACCAGCATTCCTGGCAGTCCCAAGTTCCAGTCTCCAGTCCCTGCTCCCCGAAACAAGATTGGCACACTTCAGGACCGCCCTCCCAGCCCTTTCCGTGAGCTTCCAGGCGCTGAGCGGGTATTGACAACCAGCCCCTCACGCCAGCTGGTGGGCCGAACATTTTCAGATGGTTCAGCTACCCGCACCCTGCAGCCTCCTGAAAGCCCCTGCCTGGGCCGACGGGGCCTGGACAGTATGCGAGAACTCCCTCCCTTGAGCCCGTCTCTGTCCAGACGAGCTCTCTCCCCCATGCCCTCCCGGAATACTCCAGATCCCAAACTAACTAGGGAAGTGGCAGAGAGTCCCCGGCCGCGGCGCTGGGCAGCCCATGGGACTTCACCAGAGGACTTCTCCCTGACACTGGGGTCGCGGGGCCGGAGGACACGGAGCCCCTCACCCACACTCGGGGAGTCCCTGGCACCCAGCAAGGGCAGCTTCAGTGGCAGGCTGAGCCCAGCTTACAGTTTGGGCTCTTTGACTGGGGCTTCGCCCCGTCAGAGCCCCCGTGCCCAGAGGAAACTCTCCAGCGGGGACTTACGGGTGCCTGTCACTCGAGAGAGGAAAAATAGCATCACGGAGATCAGTGACAATGAGGATGACCTCCTGGAGTACCACCGGCGGCAGCGCCAAGAACGGCTTCGGGAGCAGGAGATGGAGAGGCTGGAACGCCAGCGCCTGGAGACCATCCTGAATCTGTGTGCCGAGTACAGCCGGGCTGATGGGGGACCTGAGGCCGGAGAGCTGCTCAGCATTGGGGAGGCCACTGCAGCATTGGCACTGGCAGGCCGGAGGCCCTCACGAGGCCTTTCAGGAACCACTGGGGCCTCTGGGCGGAACAATGAGGAGCCTGGAAGTGCCACCCAACGCCTGTGGGAGAGTGTAGAACGCTCAGATGAGGAAAATCTCAAGGAGGAGTGCAGTAGCACTGAGAGCACCCAGCAGGAGCACGAAGATGCACCTAACACCAAGCTCCAGGGAGAAGTGTTGGCCCTGGAAGATGAACGGGCTCAGGTGCTAGGGCGAGTGGAGCAGCTCAAGGTCCATGTGAAGGAGCTGGAGCAGCAGCTGCAGGAGTCAGCTCGAGAGGCTGAAATGGAGCGGGCGCTGCTGCAGGGGGAGAGGGAGGCAGAGCGGGCACTGTTGCAGAAGGAGCAGAAAGCAGTGGACCAGCTGCAGGAGAAGCTGGTGACTTTGGAGACAGGCATCCAAAAGGAGAGGGACAAGGAGGCAGAGGCCTTGGAGACTGAGACAAAGCTCTTTGAGGACTTGGAGTTCCAGCAGCTGGAGCGAGAGAGCCGCGTGGAGGAGGAGCGCGAGCTGGCGGGCCAGGGGCTGCTCAGAAGCAAGGCCGAGCTATTCCGCAGCATCGCCAAGAGGAAGGAGCGGCTGGCAGTCCTGGACAGTCAGGCTGGGCAGATCCGGGCTCAGGCTGTGCAAGAGTCTGAGCGCCTGGCCCGGGACAAGAATGCCTCCCTGCAGCTGCTGCAGAAGGAGAAAGAGAAACTGACTATGTTGGAAAGAAGGTACCACTCACTCACAGGGGGCAGACCTTTTCCAAAGACCACATCAACCCTCAAAGAGAATGCTCCACTCATCCAGAATGGCACAGGCAGCCTTCCTCGCAACCTGGCAGCCACACTGCAGGACATCGAGACCAAGCGCCAACTGGCCCTGCAGCAGAAGGGGCAGCAGGTGATTGAGGAACAGCGGCGGCGATTGGCTGAGCTGAAGCAGAAAGCAGCAGCCGAGGCTCAGTGCCAGTGGGATGCTCTGCACGGGATGGCCCCCTTCCCAGCAGGCCCCTCGGGCTTCCCCCCACTCGTGCACCACTCCATCCTGCATCACCTGCCAGCTGGGCGGGAACGTGGGGAGGAGGGCGAGCACGCCTATGATACACTGAGCCTGGAGAGCTCTGACAGCATGGAGACCAGCATCTCCACAGGAGGCAACTCCGCCTGTTCCCCCGACAACATGTCCAGTGCAAGCGGCCTGGACGTGGGGAAGATCGAGGAGATGGAGAAGATGCTGAAAGAAGCTCATGCAGAGAAAAGCCGACTCATGGAGTCGAGGGAGCGGGAAATGGAGCTGCGGAGGCAGGCACTGGAGGAGGAGCGGAGAAGGAGGGAGCAGGTGGAACGGAGGCTGCAGAGTGAGAGCTCCAGGAGGCAGCAGCTGGTGGAGAAGGAGGTCAAGATGCGGGAGAAACAGTTTTCTCAGGCACGACCTCTGACCCGCTACCTGCCAAACCGGAAGGAGGACTTTGACTTGAAGACCCACATCGAGTCGTCAGGACATGGCGTCGATACCTGCCTGCACGTGGTGCTCAGCAGCAAGGTCTGCCGTGGCTACTTGGTCAAGATGGGCGGCAAGATTAAATCGTGGAAGAAGCGCTGGTTTGTCTTTGACCGGCTCAAGCGCACCCTTTCCTATTATGTGGACAAGCATGAGACAAAACTGAAGGGGGTCATCTATTTCCAGGCCATTGAGGAGGTATACTATGACCACCTGCGCAGTGCAGCCAAGAGCCCAAACCCAGCCCTCACCTTCTGTGTGAAGACCCATGACCGGCTGTACTACATGGTAGCCCCCTCTGCAGAGGCCATGCGCATCTGGATGGATGTCATTGTCACCGGGGCTGAAGGCTACACTCAGTTCATGAACTGACTGGCATGGGCCTTCTGGACCCTCAGGCCAGCCCCAGGACCCATGCCTGACGATGGCTGCTCTCTTTGGCCCTGGAGACAGAGTCACACCCTGGACTCCAGGCCTCACTGGGGCACTCCCAGAGGACCTGGGAGGGCAGAGTGTGCCTGGGGCTTTTGTACAAGACTTTGTAATGTTGTCTAAGGAGCTCATCCTGGGAGTTTCTGAGCTTGGCCCTCTAAAGAACCAGCCAGGAGATAAAAGGTAGGATGGGGCTTTACTGCCTCCTGGGAGCCCAGAACTTGCAATAACTCTTTAGGGTCCTGCCCTCCCTAGCCTGTATTCTCTTTTGTAAAGAACAAATTATGGTACCTGAATCTGCCAAAGATCCCCTCTTGCCTCAGCCCCCTTTGCAGGGGACTTGAGGGATGAGCAGAGCCACATCCAGAGTGGGGTAATAGCTCAGGCAGTATACTTCTCAAACCCTGCTCTACCCAATTATTCTTCTGCAATTATATTTTTTATTACTTTGCTCAAGGGCCAGAGACCTCAAGTGTCATCCTTGAGGTCTCAGTCCCAACCCTTTTTGCAGACCCATTATCATGGTCACCATAGTAACTGCTTCATTGCCATGGTTACATACTAATTGCTGTGGCTCCATGGCTCAGCCCACTGCTTAAGCTGTGGGCCCATCTGAGGGTATGTGCCATCATCTCTCCAGCCCAAGACCTTGGGTATCTTATGCTGGGGGGAAGGGACTGATCACCTCCCTGCCTCCAGCCTGTGTCTCCAGGCTCTGATACACAGCCTGCTGCCCCAAACCCCCTGCCCTGGGCCAGCCCTCTCCCTTCCACTCGTGCCTTGCTTAGAGCCAGAAGGGATGAAGCTGGGGCTTCTAGATCCAGAGGAGGAGCAATGCGAATGGGAGATAAAGCTATAATGGCTGTCCTCAAGATTTCTGGGGCTGAGTTTCTGACAGGGACAGAGGGCTGCTTCCTTGGGAATGTGAGCAGGAGAGGGAACAGCAGAGAGGGAGGAGTCTGAGGTCCAGCTATGCTCCCTTCGGCCTCAGAAGGGCAATGAAAATGAAGAGCAAAGGTCCAGGCCTCCAGCTGTCCAGCCTCAGCCCTTCAAGCCTTAACATTAGCCCACCTCCCTGTCCCCTTTTCCAGCACTGGGACGTGATAGCTGGGCCCAGCTGAGTGATTTTCAGTATTTGTAAGCATCTCAGCAGAACAATAAAGCATTTGGAGTATGTG