Transcript asmbl_29144

Sequence
Transcript Sequence for observation asmbl_29144 of TGE0003178:
GTTTGGTCGTTCGTTGGAGCAACTTCTTTGTTTTGGTTGGTGACTGCGGCTCTTCGTTGGGCAGTGGGAGCGGTGCGGCGGTGGGAGAGGCGGCCTAGGGCTTCAGCGTTAGGTGAAAGAAAATGGCCCGAACCAAGCAGACTGCTCGTAAATCCACGGGTGGGAAAGCGCCCCGCAAACAGCTGGCCACTAAGGCTGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAAAAACCTCATCGCTACAGGCCCGGGACCGTTGCGCTTCGAGAAATCCGTCGTTACCAGAAATCGACCGAGCTTCTGATCCGGAAGCTGCCTTTCCAGAGGTTGGTGAGGGAGATCGCCCAGGATTTCAAAACCGACCTGAGGTTCCAGAGTGCTGCCATCGGCGCTCTTCAGGAGGCTAGTGAAGCGTACCTGGTGGGTTTATTTGAAGATACTAATCTGTGTGCCATCCACGCTAAGAGAGTCACCATCATGCCCAAAGATATCCAGTTGGCTCGCCGGATACGGGGGGAGAGAGCTTAAGTGAAGGCAGTTTTTATGGTGTTTTGTAGTAAATTCTGTAAAATACTTTGGTTTAATTTGTGACTTTTTTTGTAAGAAATTGTTTATAATATGTTGCATTTGTACTTAAGTCATTCCATCTTTCACTCAGGATGAATGCGAAAAGTGACTGTTCACAGACCTCAGTGATGTGAGCACTGTTGCTCAGGAGTGACAAGTTGCTAATATGCAGAAGGGATGGGTGATATTTCTTGCTTCTCATGATGCATGTTTCTGTATGTTAATGACTTGTTGGGTAGCTATTAAGGTACTAGAATCGATAAATGTGTACAGGGTCCTTTTGCAATAAAACTGGTTATGACTTGATCCAAGTGTTTAACAATTGGGGCTGTTAAGTCTGACCATGCATCACTGTGATAGAATGTGGGCTTTTTCAAGGGTGAAGATACAAGTCTTAACCACAGTGTAACTTACAGTTTCCTTAAAAAAAGTAAACCTGGCAGCTATAGAATACACTATGTGCATTTATAATAGCTATTTTATATATTGTAGTGTCAACATTTTTAAATTAAATGTTTTACATTCACATGTGGTGGGGAGTCTTGTCATTAAGGTGTGTGTAATTTTAGAGTCCAGTTGGTTTTCTCCTAACTAGAGTGCACTTGTTTTCATAGTAGTAAAATGCTTTGCGCATCATACCTTGCATAAGTCCTCATTCTACCACATGTTAACTAACTCTAGCTGATAATGCAAACACTAACGGGGAATTTTATTTATAAGGGCTCTAGAATATAATACAAGTTATTCACACCAGCATCATCTGTTACTAATCTGAACTAGTTAGTGCAGCTTTTCTTTGTGTTGTGGTTGGTCTCATAACTAGGTTGAGTTTTTCTCTAAGTAGAGGAAACAATACGGAAATTCTTTTCCTTGTGGAGTTTGTATTATAAGGCTTAGAGTAAACTTGTGGTGGGGGAGGGGCACACAGCTCCAGCTTTTCGAACCTCAGCCAGTTAAGATGGCGTCTAGTGAGGTTACATCTGGTATATGGTTCTGGGGAAATCACTTTAGAGATGGTCTTCCAAGTGGTTTTTAAATTTATCCTTCTATTGAAGTTTTTAGGTCAATTATGTATGTTGACTAAATTTACAAATAAACTTGTTTATCCAACTAAGTGTCAAAAACCTAAATTGAATGTACAAACCCACCCATTATCTAGGTCCTTTGTATCTTAAAGTTTGAGTTTAGCTTTTTTAGGTTTTGCTTGGTAGATGAACCTTTTATTTACAAAAATAGTCATAGAAAGCATGTAAAAGTCCCTCTGCTCTGAAAAATGCCATGATTGCTATTTTTTGCAGTGCGGGCTTAAGACGTATTAATATGCTTCCCTTTGCCCCCATGTTGTCAAGGTATAAAAATTTGTCTATTCAAGGTATAACAGGTCAAGGAAAGTAAATTTCTTTAAAATTCGAGGGCTCAAATTTGGTATCTGTTCCAAGAACCTTTTCTGGCAGTATGTAGATCTCTACGTAGCAAATTATTTTAACAGAAGCGCAGAGGTAGAGAATTCATTGGTCTAAGCCACCTTTTCAGTATAAAAACTAGTTTTCTTGACCAATGATGGGCAGCAGTAAAGCTCAGTATATGTCAGCTGGATGTGGGCACAAGAGCCACCAATCATTAGGAGGTGTTCGGTATATTTAAAGTTAGCTGTAGGAACACATTTTTGCCCTAAAGGCTTTTTTAATAAGTTAGCATTAGTTTCAACTTTAAAGGGTTTGTGAAGAAGCTAGCTAGAGTAGCCTTGGGAGTCCTGGTTAAACAGCCTTAGGGGGGATATCAAAGGCGGAGTCCAATACAATACAAAATACAATGAATGGTTTTGTAAAAGGTCCATTATAACCAGTGCTTGGAACAATGACTGACTGAGAACTTATGTTGTTACTTCCGAAGGAAGTTGAAGTCCTAGACATTGGGATATGCTGTGCTCTGGAGTGTGGCAGTGTTTGAACACAAGTAGAAGCAGCTATGAGTTAGCTTGAGTTTCTACCTGTGGTAACAAGCGGGTAACGCTTGAACTTTACGCAGTCTGTGTCTTGATGTAGAAAGTTCTTGAATTTTATTGGGTGACTTGGAATTTGCTGCTTAAATAGTGTAACACTTCCATACTTTACTTGAGCACACATCACAGAAGGCAAAAATATTTTTTGGTTCTAGGAAGGTACCCACACAGGAGATAATCTGGGTATAGGTGATGGAACAGAGTCTGTAAGGAGAAAAGCAAAAATTGGAGCTGATGAAAGGTATCCTGTGCCCTTGATGGATGAGACAAAAATAAAGTTTTTGAAGTTGCAGA