Transcript asmbl_29099

Sequence
Transcript Sequence for observation asmbl_29099 of TGE0004678:
CTCGCCCTGAGCTCCGGGTCCCACAGAGCGCGTCGCGGCCTTTCGTACGAGGAGGCTGGGCATCTTGGACCGCTCCCCTCCTCTGCCGGGTTCCTTGGCATCTTCTCCGGCCGGACCCCCGGGCCTCGCGGCCCCCTCAGTCGGCACCGTTCCCGGCTGCAGCCCCGCGCGGGCCGGCTGTAACCGCGCCGCGGGCCGGACGATGCCCAGGAAGCTGCTGCTGCTGCCCCCGCGCTCCGTGCCCTCGGCTTTCCGCGCCCCGCGAGCCAGCTCCTCCGCAAGCGCGGCCATGAACGCCGCCCGCACCGGCTACCGAGTCTTCTCGGCCAACTCCACGGCCGCCTGCACCGAGCTGGCCAAGCGCATCACCGAGCGTCTTGGTGCTGAATTGGGGAAGTCTGTGGTATATCAAGAGACCAATGGAGAAACAAGAGTTGAAATAAAAGAATCTGTTCGTGGCCAAGATATTTTCATTATACAGACAATACCCAGAGATGTGAATACAGCTGTGATGGAGTTGCTGATCATGGCTTATGCGCTGAAGACGGCCTGTGCCAGGAATATTATCGGAGTCATCCCTTATTTCCCCTACAGCAAGCAAAGCAAGATGAGGAAGAGGGGTTCCATCGTGTGCAAGCTACTAGCATCCATGCTGGCGAAAGCAGGTTTAACTCACATTATCACTATGGACCTTCATCAAAAGGAAATACAAGGCTTTTTCAGCTTTCCCGTGGACAACCTTAGAGCCTCACCTTTCCTGCTTCAGTATATCCAGGAAGAAATTCCAAATTACAGAAATGCAGTCATCGTAGCGAAGTCTCCTGATGCTGCAAAAAGGGCCCAGTCATACGCTGAGAGGCTCCGTCTGGGTCTAGCCGTGATCCACGGAGAAGCACAGTGCACAGAGCTGGATATGGACGACGGTCGTCACTCACCTCCGATGGTCAGAAATGCCACCGTCCACCCGGGCCTGGAATTGCCGTTGATGATGGCCAAAGAGAAGCCACCGATAACTGTCGTCGGAGACGTCGGAGGGAGCATCGCGATCATAGTGGATGACATCATCGACGACGTGGAAAGTTTTGTCGCTGCGGCAGAGATCCTGAAGGAGAGGGGCGCTTACAAGATCTACGTCATGGCCACTCACGGCATCCTGTCCGCAGAGGCCCCCCGCCTCATCGAGGAGTCCTCCATCGATGAGGTGGTGGTGACGAATACTGTCCCTCACGAGGTGCAGAAGCTGCAGTGTCCCAAGATAAAGACTGTGGACATCAGCCTGATTCTCTCTGAGGCCATTCGGAGAATCCACAACGGAGAGTCCATGGCGTACCTCTTCCGGAACATCACTGTGGACGACTAGCTTTCTCTGGAACTCCTGAGACGCGTGGGAGGCGGCAGCAGTGTGACGTCCGCAGCGTTTCCTTGCAGGGGACTCGGGTGGTCTCGTGCCGTTCGCTTTGTAGGAGGCTTTAAGATAGTCGAGGGGGAGACACAGCTAATGGGTAAAGGGCCTTAAACGTCTGCCCTCACCATCCCGTCCCTCAAACAGAAGTCACATTTTCCTGAAAAGAACCTGAACATCTTCTGACACTGCAAAGGCGTTAGAGGCAGAGACAGTGCTAACTCTGGTGTCCGTTCAGCTGTTTCGGCCGCAGGGAGACGTGTGTTCACGTTGAACTTGGGCGGGCAGCTGGGCGCCCCGGCTCTGTGCCTGCTGCAGTTGTCCTCTCCCTGGCCAACTGCACGTAAACCTTTTGTAGAGAACCGTGTTTTCCTCTGAGAAGCTGCTGTGCGTACAGCCTCTGAACCATAAAGCATTTAGCGTCATCCCCAGCAAGGCCCTAGATAGAGAATAAGACCCTGTCTCTCGGTGTCTGCATTGCTCTTAAATTACAAATAAAGGAATTTGTTATCTTGCTCGTCTGGTCACTCCATTGCAGAGCCGCCCACTGCCCCGCCTCAGGGTGACTAACTGCTGCCGAGTCTGCAGAAGGCAATGGATGTAAAATAAAGGCTGGTTTAGGTCCATGGCTGGTCCCAAACCCTGGATGTAAGTCTCCTTCTGCAGGTTCCGTCCCCTTCCTGAGCACCGAAGTTAAATCCTTGTTTAACGTGTTTAAGATCTAAATTTGTAAAAAACAGGACTACTTGTACTGGTTCCT