Transcript asmbl_29045

Sequence
Transcript Sequence for observation asmbl_29045 of TGE0004671:
CTTCCGCTGAGGCGCGCGCTTTGCTCTCATCCTGTTCGGGATCATGGCGGCCACGGCCACGATGGCGACCTCTGGCTCGGCGCGGAAGCGTCTGCTCAAAGAGGAAGACATGACCAAAGTGGAATTCGAGACCAGCGAGGAGGTGGACGTGACCCCCACGTTCGACACCATGGGCCTGCGGGAGGACCTGCTACGCGGCATCTACGCCTACGGATTTGAAAAACCGTCGGCAATCCAACAGCGAGCCATCAAGCAGATAATTAAAGGGCGAGATGTCATCGCACAGTCTCAGTCTGGCACAGGCAAAACTGCCACCTTCAGTATTTCCGTCCTCCAGTGTTTGGATATTCAGGTTCGTGAGACCCAGGCTTTGATTTTGGCCCCAACGAGAGAGCTGGCTGTGCAGATCCAGAAGGGCCTGCTCGCTCTGGGTGACTACATGAACGTCCAGTGTCACGCCTGCATCGGGGGCACCAACGTGGGGGAGGACATCAGGAAGCTGGACTATGGACAGCACGTGGTCGCCGGCACGCCGGGCCGTGTCTTTGATATGATTCGTCGCAGAAGTTTAAGGACACGTGCTATCAAGATGCTGGTTTTGGATGAGGCCGATGAAATGCTGAATAAAGGTTTCAAAGAGCAGATCTACGACGTGTACAGGTACCTGCCCCCGGCCACGCAGGTGGTGCTCATCAGCGCCACGCTGCCCCACGAGATCCTGGAGATGACCAACAAGTTCATGACCGACCCCATCCGCATCCTGGTGAAACGTGACGAGCTGACTCTAGAAGGCATCAAGCAGTTTTTTGTGGCGGTGGAGAGAGAAGAGTGGAAATTTGACACTTTGTGCGACCTCTACGACACGCTGACCATCACACAGGCTGTCATCTTCTGCAACACCAAAAGGAAGGTTGACTGGCTGACAGAGAAGATGAGAGAAGCCAACTTCACCGTGTCGTCGATGCATGGGGACATGCCACAGAAGGAGCGGGAGTCCATCATGAAGGAGTTCCGGTCTGGTGCCAGCCGCGTGCTCATTTCCACCGACGTCTGGGCCCGGGGGCTGGACGTCCCTCAGGTGTCCCTCATCATCAACTATGACCTGCCCAACAACAGAGAGCTGTACATCCACAGGATCGGCCGGTCGGGCCGGTACGGCCGGAAGGGCGTGGCCATCAACTTCGTAAAGAACGATGACATCCGCATCCTGCGGGACATCGAGCAGTACTACTCCACGCAGATCGACGAGATGCCCATGAACGTTGCCGACCTGATCTGAGGCGCCCGCCGGGGTCCCGCAGCCACGGGGGCCGTTCCGGGCCGGTCCTCGTTCCTGGATCATGTGGATTCTCCTCACAGAGTGCTGGTGGTGGTAGAGGTTCTTCCTTTTCTTACTTATGTGTAAATAGCGCTTTGCTTTATGTGTTTTTCATTAAACGCTTGAAACTCTTCCGTTGAACTTCCTGA