Transcript asmbl_29014

Sequence
Transcript Sequence for observation asmbl_29014 of TGE0015454:
CCGGGCGCTGTGAACATGGCCGTCCTGGGCGCACTGCCTGGGGCTTGGGCCGGGCAGCGTGTGTCCCCGTGGGGCTCCTGCGGGCAGCCTGACCCCGCTCTGCCTGCCTCCAGCCACACCTGATGAGCCAGGAGCTGCCTGAGGACTGGGACAAGCAGCCTGTCAAAGTGCTGGTTGGGACCAACTTTGAAGAGGTGGCTTTCGATGAGAAGAAGAACGTCTTCGTGGAATTCTACGCCCCCTGGTGCGGCCACTGCAAACAGCTGGCTCCCATTTGGGATAAGCTGGGAGAGACGTACAGGAACCACGACAACATTGTCATCGCCAAGATGGACGCGACGGCCAACGAGGTGGAGGCCGTTAAAGTTCACAGCTTCCCCACGCTCAAGTTCTTCCCTGCCAGCGCAGACAAGACGGTCATCGACTACAACGGGGAGCGCACCCTGGAAGGCTTTCGCAAGTTCTTGGAGAGTGGCGGCCAGGACGGGGCAGGGGATGACGATGATCTCGAAGACCTAGAGGAGGCAGAAGAGCCCGACCTGGAGGAAGACGACGATCAGAAAGCTGTGAAGGACGAACTGTGATGTCACAACCAGCCCAGCACCCTGACGCGCCCTCGGAGCTGCAGCCCCTCAGCGAGGCTTGGGAGCCCGGGAGCCCGGGCCCCCGGGGAGGAGGCGCACCAGCCAGAAGTGCGGGGGACTTCCTGAGGCGACACCTCACTGACACGCGTAGGCTTAGACCCGCCTCTCCTTCCGCCTTTCCGTTCCTGGAAAGGACCCTCCCCAGGCCAACGTCGGGGCCCATTTTTTTAATTGATGTACTTTTTCGTACACGGTTTCTTCCAGAACGCGCCCAAAAATGTTTGCGAATCTCACGTGGCAGTGTCTCCTTCCCGTTAGGTTTATACTATCACTTTTAAAAATTTCCATCTGTGGGATTCTTGGACATTTTTGGACATCGGGGTCTCTGCTCACCTTGGTCGGGTCACCCTGGAGACCGATGTGCCCTGTGTGGAAAGGGCCCAAGCCATGCTGGACGGGTCACCCCCCTCACACCCATGTTGCTGTGACCGAGTGTGGCTCCCGCAGCGTGTGGTTAAATGGAGACTTCCGGTCTCTGTCGCAGAGGCCGCCATGACTGGGGGGTGCCGGTGGGGCCAAGACAGGGCCTTCTCCCCGAGCCAGGCTCCTCACCGCGGAGGCCTGAGCCGGCCTGAACCAGGACCCTCCACTTCCAGGCTGGGACACAGCCGCGGGAGCTCGAGCCCGGCCAGCCGTTAGCGGTCCTCAGGTCCCTCCACCACAGCGTGGGGACAACTCATTGGCCAAATAAACTTCCAATTTCA