Transcript asmbl_29013

Sequence
Transcript Sequence for observation asmbl_29013 of TGE0015453:
CTTCTGGGGAGCCCATGCTCCTTCCCTGGGGACGCACTCGGAAGGGTGCTGATTCCTGCAGGCCTCCCCAGCTGTGATTTATGGACAGAGGCACGTGGGGCCTGCTCGCTTGTCTCTGAACTCCAGACAGGAAGACGGGGCCGCAAGGCCGCTGCCCCGGATCCTGGGCTGGGGGCGTTGGCGCACGGCGGCTCTGCCGAGTCCCCGGGGCTCAGGGTCTCTCTCCGTCCCCAGTTTGACGAAGGCCGGAACGACTTTGAGGGGGAGGTCACCAAAGAGAAGCTGCTGGCCTTCATCAAGCACAACCAGCTGCCGCTGGTCATCGAGTTCACCGAGCAGACGGCCCCGAAGATTTTTGGAGGGGACATCAAGACTCACATTCTGCTGTTCCTGCCCGAGAGTGCGCCTGACCGCGACGGCAAGCTGAGTGGCTTCAAGAAGGCTGCCGAGCGCTTCAAGGGCAAGATCCTGTTCATCTTCATCGACAGCGACCACGCCGACAACCAGCGCGTGCTCGAGTTCTTCGGCCTGAAGAAGGAGGAGTGTCCGGCCGTGCGCCTGATCACCCTGGAGGAGGAGATGACCAAGTATAAGCCAGAGTCAGCCGGGCTGACGGCAGACGAGATCACGGACTTCTGCCAGCGCTTCCTGGATGGCAAGGTCAAGCCACACCTGATGAGCCAGGAGCTGCCTGAGGACTGGGACAAGCAGCCTGTCAAAGTGCTGGTTGGGACCAACTTTGAAGAGGTGGCTTTCGATGAGAAGAAGAACGTCTTCGTGGAATTCTACGCCCCCTGGTGCGGCCACTGCAAACAGCTGGCTCCCATTTGGGATAAGCTGGGAGAGACGTACAGGAACCACGACAACATTGTCATCGCCAAGATGGACGCGACGGCCAACGAGGTGGAGGCCGTTAAAGTTCACAGCTTCCCCACGCTCAAGTTCTTCCCTGCCAGCGCAGACAAGACGGTCATCGACTACAACGGGGAGCGCACCCTGGAAGGCTTTCGCAAGTTCTTGGAGAGTGGCGGCCAGGACGGGGCAGGGGATGACGATGATCTCGAAGACCTAGAGGAGGCAGAAGAGCCCGACCTGGAGGAAGACGACGATCAGAAAGCTGTGAAGGACGAACTGTGATGTCACAACCAGCCCAGCACCCTGACGCGCCCTCGGAGCTGCAGCCCCTCAGCGAGGCTTGGGAGCCCGGGAGCCCGGGCCCCCGGGGAGGAGGCGCACCAGCCAGAAGTGCGGGGGACTTCCTGAGGCGACACCTCACTGACACGCGTAGGCTTAGACCCGCCTCTCCTTCCGCCTTTCCGTTCCTGGAAAGGACCCTCCCCAGGCCAACGTCGGGGCCCATTTTTTTAATTGATGTACTTTTTCGTACACGGTTTCTTCCAGAACGCGCCCAAAAATGTTTGCGAATCTCACGTGGCAGTGTCTCCTTCCCGTTAGGTTTATACTATCACTTTTAAAAATTTCCATCTGTGGGATTCTTGGACATTTTTGGACATCGGGGTCTCTGCTCACCTTGGTCGGGTCACCCTGGAGACCGATGTGCCCTGTGTGGAAAGGGCCCAAGCCATGCTGGACGGGTCACCCCCCTCACACCCATGTTGCTGTGACCGAGTGTGGCTCCCGCAGCGTGTGGTTAAATGGAGACTTCCGGTCTCTGTCGCAGAGGCCGCCATGACTGGGGGGTGCCGGTGGGGCCAAGACAGGGCCTTCTCCCCGAGCCAGGCTCCTCACCGCGGAGGCCTGAGCCGGCCTGAACCAGGACCCTCCACTTCCAGGCTGGGACACAGCCGCGGGAGCTCGAGCCCGGCCAGCCGTTAGCGGTCCTCAGGTCCCTCCACCACAGCGTGGGGACAACTCATTGGCCAAATAAACTTCCAATTTCA