Transcript asmbl_28983

Sequence
Transcript Sequence for observation asmbl_28983 of TGE0015445:
TAAAGTCAGGGTATCGGGGGGACTCGTCCTGGCTGCTCCCGTCCGCTGGCGCTGGCCCCGATGGGCTGGGGGGCAGGCGGATGGCCTGAGGGCCTCGCGGGGCATGAGGCCGAGGCCTCGACTGGGCAGAGTGGCCTGGGGTGCTGTGGTAATGACACCTTTGTGGGGAAAGCGCCTCGTAAGGGTGCATCTCCGCGGCGGTCATTACCGGTCCCGGTCACTGGGGCCCCCTCTGAGGCCGCCTCCGCCCACAGGCTTGTCCTGGGAAGAATGTCGGCGGCGCTGCCCCCCTGGCATCGTGCCCGCCTGCCACAACTCCGAGGACACAGTGACCATCTCGGGACCTCAGGCCGCGATGTCCGAGTTCGTGGCCCAGCTGAAGCAGGACGGTGTGTTCGCCAAGGAGGTGCGGACGGGTGGCCTGGCCTTCCACTCCTACTTCATGCAGGACATCGCGCCCTCGCTGCTGCAGACGCTCAAGAAGGTGATCCGGCAGCCGCGGCCCCGCTCTGCGCGCTGGCTCAGCACGAGCATCCCCGAGGCCCAGTGGCAGAGCAGCTTGGCCCGCACCTGCTCGGCCGAATACCACGTGAACAACCTGGTAAGCCCCGTGCTGTTCCAGGAGGCGCTGTACCACGTGCCCGAGAACGCCGTGGTGCTGGAGGTCAGCCCCCACGCCCTGCTGCAGGCCATCCTGAAGAGGGGCCTCCGGTCCAGCTGCACCGTCATCCCCCTGATGAAGAAGGAGCACCCGGACAACCTGCAGTTCTTCCTCAGCAACATGGGCCGGGCCCACCTGGCAGGCATCAACATCAACGCCAATGGCCTATTCCCACCCGTGGAGTTCCCAGCTGCCCGGGGGGTTCCCCTCATCTCCCCCCACATCAAGTGGGACCACAGAGAGACCTGGGACGTCCCCAGTGTGAAGGACTTCACCAGCAGCTCCAGCGGTGGGGGAGCCACGGTCTACAACATCGACACCAGCACGGAGTCCCCCGACCACTACCTGGTGGACCACTGCATTGACGGCCGCGTCATCTTTCCCGCCACTGGCTACCTGTGCCTGGTCTGGAAAACTCTGGCACACGCCCTGGACCAGAACGTGGAGCAGATGCCCGTGGTTTTTGAGGATGTGACGCTGCACCAGGCCACCATCCTGCCCAAGACAGAGATCGTGGCCCTGGAGGTGCGGCTCCTGGAGGCCTCCCATGCCTTCGAGGTCTCCGACAAAGGCAACCTGATAGTGAGCGGGAAGGTGTACCAGTGGGAGGACCCCGACCCCAAGCTCTTCGACAGCCAGGGTGGCCTGGCTCCAGAGGCGCCGACAGGCCCAGAGGCAACGTCCCGCCTGGCCCCGGGGGACGTGTACAAGGAGCTGCGGCTGTGTGGCTACGACTATGGCCCCCAGTTCCAGGGCATCCACGAGGCCAGCTTTGAAGGCAACACAGGCAAGCTCCTGTGGAGGGACAACTGGGTGGCCTTCCTGGACAGCATGCTGCAGATATCCATCCTGGGCACCAGCCAGCGCAGCCTGCGCCTGCCCACCCGCATCGCTGCCGTGCACATCGACCCCGCCACCCACCGGCAGAAGGTGTACGCCCTGCAGCGCGAGACGCAAGTGGTCGACGTGGTGGTGGACAGGTGTCTACAGAGCACGGTGGCCGGGGGCGTTCTCATCTCGCGGATGCACACCTCGGTGGCCCCGAGGCGGCAGCACGACCAGTCGCCCACCCTGGAGAAGTTCTGCTTCACGCCGCACCTGGAGGCCCGGTGCCTGGTCAAGAGCGCGGCCCTGCAGGAGGAGCTGCAGCTGTGCCGGGGGTTGGCGCGAGCACTGCAGACCAAGGTGGCCCAACAGGGACTGAAGATGCTGGTGCCTGGGTTGGATGGGGCCCAGGCCCCCCGGGAGCCCCCGAAACAGGGCCTGGCCCGGCTGCTGGCGGCCGCCTGCCAGCTCCAGCTCAACGGCAACCTGCAGCTGGAGCTGGGGCAGGTGCTGGCACAGGAGAGGGCCCTGCTGCATGCGGACCCCCTGCTCTGTGGCCTCCTGGATGCGCCGGCGCTCAAGGCCTGCGTGGACACCGTGCTGGAGAACATGGTCAACTTCCGGATGAAGGTGGTGGAGGTGCTGGCTGGTGACGGCCACCTGTACTCCCGCATCCCGGCCCTGCTCCGCATCCATCCCATGCTGCAGCTGGACTACACAGCCACCGACCGCCACCCGCAGGCCCTGGAGTCTGTCCAGGCCAAGCTGCAGCAGCATGGCGTGGCCCAGGGCCAGTGGGACCCCGCAGGCCCCACCCCCAGCGGCCTGGGCCCGGCAGACCTCCTGGTATGCAACTGCTGCATCTCCAGCCTCGGGGACGTGGCCACGGCCCTCAGCAACATGGCGGCCACCCTCAAGGATGGTGGCTTCCTGCTGCTGCACACCCTGCTCAGAGGACACCCCCTCGGGGACACGGTCGCCTTCCTGACCTGCCCCGAGCCGCAGCCTGGAGGGCAGAGCCTCCTGAGCCAGGATGAGTGGGAGAGCATGTTTGCCAAGACGTCTCTGCGCCTGGTGGCCCAGAAGAAATCTTTCTACGGCTCCGTGCTCTTCCTGTGCCGCCGGCTGGCCCCTCCGGAGAGCCCCATCTTCCTGCCTGTGGAAGACACCAGCTTCCAATGGGTGGACCCGCTGAAGGACATTCTCTCCGCGGCCTCCTCCCAGCCTGTGTGGCTGACTGCAGTCGGCTGCAGCACCTCGGGTGTCGTGGGCATGGTCAACTGTCTTCGCAAGGAGCCCGGCGGGCACCGGGTCCGGTGCATCCTGCTGTCCAACCTCAGCAGCACGTCCCCCGTCCCCAAGATGGACCCGAGCTCCCCAGAGCTGCAGAAGGTGCTGCAGGGGGACCTGGTGATGAATGTCTACCGGGACGGGGCCTGGGGGGCCTTCCGCTTCTTCTTGCTGGAGCATGACCAGCCGGAGGAGCAGACGGAACATGCCTTCGTCAACGTCCTCGTCCGAGGGGACCTCTCCTCCATCCGCTGGGTTTGCTCCCCGCTGCGCCACGCCCCAGCCCCCCGCCCCGGCTCTCGCCTCTGCACCACCTACTACGCCTCCCTCAACTTCCGGGACATCATGCTGGCCACGGGCAAGCTGTCCCCTGACGCCATCCCAGGGAAATGGGTCAACCGGGACTGCATGCTGGGCATGGAGTTTTCCGGCCGTGACGCCAGCGGCAAGCGCGTGATGGGGCTGGTGCCCGCCGAAGGCCTGGCCACCTCCGTCATGCTCTCTCAGGACTTCCTGTGGGACGTGCCCTCCAGCTGGACCCTGGAGGAGGCGGCCTCGGTCCCTGTCGTCTACACCACCGCCTACTACTCGCTGGTGGTGCGCGGGCGCATGCAGCGCGGGGAGACAGTGCTCATCCACTCGGGCTCGGGCGGCGTGGGCCAGGCCGCCATCGCCATTGCCCTCAGCCTGGGCTGTCGTGTCTTCACCACCGTGGGCTCAGCCGAAAAACGGGCGTACCTCCAGGCCCGGTTCCCCCAGCTCAATGACACCAGCTTCGCCAACTCGCGGGACACGTCCTTCGAGCAGCACGTGCTACGGCACACAGATGGTAAAGGCGTGGACCTGGTGTTGAACTCCTTGGCGGAGGAGAAGCTGCAAGCCAGCGTGCGGTGCCTGGCCCAGCATGGCCGCTTCCTGGAAATCGGCAAATTTGACCTTTCCAACAACCACCCGCTGGGCATGGCCATCTTCCTGAAGAACGTGACCTTCCACGGGATCCTGCTGGATGCGCTCTTTGAAGAGGCCAACAGCAGCTGGCGGGAGGTGGCGGCCCTGCTGCGGGCGGGCATCCGGGATGGCG