Transcript asmbl_27803

Sequence
Transcript Sequence for observation asmbl_27803 of TGE0015407:
CGGGTATAAAGTGAGAAGACATCTGCGTGCTGCCCCTCCTGTCCGCAGCCTGCAGTCCCGGTTCCGCGCCGCCCACTCACCTGCACCCGACCTGCTTGTGCCCAGATCGCTGGTAGCTCATTGCACCATGTGTGGCATTTGGGCTCTCTTTGGCAGCGATGACTGCCTTTCTGTTCAGTGTCTGAGTGCTATGAAGATTGCACACAGGGGTCCAGATGCATTTCGTTTTGAGAATGTCAATGGATACACCAACTGCTGCTTTGGATTTCACCGGTTGGCAGTGGTCGACCCCCTGTTTGGAATGCAGCCAATTCGACTGAAGAAATATCCTTATTTATGGCTCTGTTACAATGGTGAAATCTACAACCACCAGAAGCTGCAACGCCATTTTGAATTTGAATATCAGACCAAAGTGGATGGTGAGATAATCCTTCATCTTTATGACAAAGGAGGAATTGAACAAACGATTTGTATGTTGGATGGGGTATTTGCATTTATTTTACTGGATACAGCCAATAAGAAAGTGTTCCTGGGCAGAGACACCTATGGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCCGTATGTTCAGAAGCTAAAGGTCTTGTTAACTTAAAGCACTCCACAGCTCCTTTTTTAAAAGTGGAGCCGTTTCTTCCTGGGCACTATGAAGTCTTGGATTTAAAGCCAAATGGCAAAGTTGCGTCGGTGGAAATGGTTAAATACCATCACTGCAGAGATGAGCCCCTGCATGCCCTCTATGACAATGTGGAGAAACTGTTTCCTGGTTTTGAGATAGAAACTGTGAAGAGCAACCTCCGGATCCTTTTTGACAATGCTGTTAAGAAACGTTTGATGACGGACAGAAGGATTGGCTGCCTTTTATCAGGGGGCTTGGATTCCAGTTTGGTTGCTGCCACCCTGTTGACGCAGCTCAAAGCGGCCCAAGTACAGTACCCCCTGCAGACATTTGCGATTGGCATGGAAGACAGTCCTGATTTACTGGCTGCTAGAAAGGTGGCAAATCATATTGGGAGTGAACATCACGAAGTCCTCTTCAACTCAGAGGAAGGTATTCAGGTCCTGGACGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTGCGTGCTTCAGTCGGTATGTACTTAATTTCTAAGTACATTCGAAAGAACACAGATAGCGTGGTCATCTTCTCTGGAGAAGGTTCAGATGAACTCACTCAGGGTTACATATATTTTCACAAGGCCCCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAAGGAACTCTATTTGTTTGATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGCCTTGAATTGAGAGTCCCATTCCTGGATCATCGGTTTTGTTCCTATTACTTGTCTCTGCCACCAGATATGAGAATTCCCAAGAATGGGATAGAAAAACATCTCCTGAGAGAGACATTTGAAGACTCTAATCTGCTACCTAAAGAGATTCTCTGGCGACCGAAAGAAGCCTTCAGTGATGGCATAACCTCAGTCAAGAATTCCTGGTTTAGGATTTTACAGGAATATATTGAACATCAGGTCGACGATGCAACGATGGCAGCTGCAGCCCAAAAATTTCCCTTCAATACTCCTAAAACTAAAGAAGGCTATTACTACCGTCAGATCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGACCCATTACTGGATGCCCAGGTGGATCAATGCCACTGACCCTTCTGCCCGCACTCTGACCCATTACAAGTCAGCCGCCAAAGCTTAGGCCCTCTCTAAGCAATGGAGTGAAAGTAAATGTTTCTTCTTCTTATGAGGGGTAGGGGACTTGGGGTCAGGCAGGGGAACGAAGAGGATCAATCAGGCAGGCTTGCTTGGGGGTGAAAAAAATAAAAGTCTTAAATCTGAA