Transcript asmbl_27161

Sequence
Transcript Sequence for observation asmbl_27161 of TGE0004556:
GGAAGATGTTGGCTATTTGGCGATAGAAGTGGTGAAAACTGACCTCACACCGGTAGACGAGCACTACGGGACCTGATCCTCTTGCTGCACGGGCAGCCGGCCCCCACTGAGCATGTTGGGAAGCCATGGAGTCCACTGGAAAACACTAGTCTGATCTTGGAAGTGGCTGATTGTGGCAGGATGTGTCGACGATGATGATGGCCAGAAAGCAAGATGTCCGTGTTCCCACCTACAACATCAGCGTGGTGGGGCTGTCTGGGACCGAGAAGGAGAAGGGCCAGTGCGGCATCGGGAAGTCCTGTCTGTGCAACCGCTTCGTGCGCCCGAGCGCCGACGAGTTCCACTTGGACCACACCTCTGTCCTCAGCACCAGTGACTTTGGCGGGCGGGTGGTCAATAATGACCACTTCCTCTACTGGGGAGAAGTCAGCCGATCCCTGGAGGATTGCGTGGAATGTAAGATGCACATCGTGGAGCAGACTGAGTTCATTGACGATCAGACCTTTCAGCCGCATCGAAGCACGGCCCTGCAGCCCTACATCAAGAGAGCTGCCGCGACCAAGCTCGCGTCGGCTGAGAAACTCATGTACTTTTGCACTGACCAGCTGGGGCTGGAGCAGGACTTTGAGCAGAAACAAATGCCAGATGGAAAGCTGCTGATCGATGGTTTTCTTCTCGGCATTGACGTTAGCAGGGGCATGAATAGGAACTTTGATGACCAGCTCAAGTTTGTCTCAAATCTCTACAATCAGCTTGCAAAAACAAAAAAGCCCATCGTGGTGGTCCTGACTAAGTGTGATGAGGGCGTCGAGCGGTACATTAGAGATGCACATACTTTTGCCTTAAGCAAAAAGAACCTCCAGGTTGTGGAGACCTCAGCAAGATCCAACGTCAACGTGGACTTGGCTTTCAGCACCTTAGTGCAACTCATTGATAAAAGTCGGGGAAAGACGAAAATCATCCCTTACTTTGAAGCTCTCAAGCAGCAGAGTCAGCAGATAGCTACGGCAAAAGACAAGTACGAGTGGCTGGTGAGTCGCATTGTGAAAAACCACAACGAGAACTGGCTGAGTGTCAGCCGAAAGATGCAGGCCTCCCCTGAGTACCAGGACTACGTCTACCTGGAAGGGACCCAGAAAGCCAAGAAGCTGTTTCTCCAGCACATCCACCGCCTCAAACACGAGCACATCGAGCGCAGGAGGAAGCTGTACCTGGCAGCTCTGCCGTTGGCTTTCGAAGCTCTTATACCCAATCTGGATGAAATAGACCACCTGAGCTGCGGAAAAGCCAAAAAGCTCTTGGAGACCAAGCCGGAGTTCCTGAAGTGGTTCGTCGTGCTCGAGGAGACCCCGTGGGATGCCACCAGCCACATCGACAACATGGACAACGAGCGGATTCCCTTCGACTTGATGGACACTGTCCCCGCAGAGCAGCTGTATGAGGCCCACTTAGAGAAGCTGCGGAACGAGAGGAAAAGAGCTGAGATGAGGAGGGCGTTTAAAGAAAACCTGGAGACCTCGCCTTTCATAACTCCTGGCAAGCCCTGGGAAGAGGCCCGCAGTTTCATCATGAATGAAGATTTCTACCAGTGGCTGGAAGAATCTGTATACATGGATATCTATGGCAAACACCAAAAGCAAATTATAGACAGGGCAAAGGAGGAGTTTCAGGAGCTGCTTTTGGAATATTCAGAATTGTTCTATGAGCTGGAGCTGGACGCTAAGCCCAGCAAGGAGAAGATGGGTGTTATTCAGGATGTCCTGGGGGAAGAACAGCGGTTTAAAGCGCTGCAGAAGCTCCAGGCGGAGCGCGATGCCCTCATCCTGAAGCACATCCACTTCGTGTACCACCCAACAAAGGAGACGTGCCCCAGCTGCCCAGCCTGCGTGGACGCTAAGATCGAGCACTTGGTTAGTTCCCGGTTTATCCGACCATCTGACCGGAATCAGAAAAATTCACTCTCTGACCCCAACATCGATAGAATCAACTTGGTTATCCTGGGCAAAGATGGCCTTGCCCGAGAGTTGGCCAATGAGATTCGAGCTCTTTGTACAAACGATGACAAGTACGTGATAGATGGTAAAATGTATGAGCTTTCCCTGAGGCCGATAGAAGGGAACGTCAGGCTTCCCGTGAACTCTTTCCAGACGCCCACGTTTCAGCCCCACGGATGTCTCTGCCTCTACAATTCGAAGGAGTCGCTGTCCTACGTGGTGGAGAGCATCGAGAAGAGTAGAGAGTCCACACTCGGCAGGCGAGATAATCACTTAGTCCATCTCCCCCTGACGCTAATTCTGGTGAACAAGAGAGGAGACACCAGCGGAGAGACGCTGCATAGCTTAATCCAGCAAGGCCAGCAGATCGCCAGCAAACTCCAGTGTGTCTTCCTGGACCCTGCCTCTGCCGGCATCGGTTATGGACGCAACATTAACGAAAAGCAGATCAGTCAAGTGTTGAAAGGACTCCTGGACTCTAAGCGTAACTTAAACCTGGTCAGTTCTACCGCTAGCATCAAAGATCTGGCTGACGTTGACCTGCGAATTGTCATGTGTCTGATGTGCGGAGACCCTTTTAGTGCAGACGACATCCTCTTTCCCGTCCTTCAGTCCCAAACCTGTAAATCTTCCCATTGCGGAAGCAACAACTCTGTTTTACTTGAACTACCAATCGGGCTACACAAGAAGCGCATTGAACTGTCTATTCTTTCATACCATTCCTCGTTTAGCATCAGAAAAAGCCGGTTGGTCCATGGGTACATTGTTTTTTATTCAGCCAAACGTAAGGCCTCCTTGGCTATGTTACGTGCCTTTCTTTGTGAAGTGCAGGATATTGTCCCCATTCAGCTGGTCGCACTCACTGACGGCGCTGTAGATGTCCTGGACAATGACTTAAGTCGGGAGCAGCTGACCGAGGGGGAGGAGATCGCTCAAGAGATAGATGGCAGGTTCACAAGCATCCCCTGCAGCCAAGCCCAGCACAAACTCGAGATCTTCCACCCATTTTTTAAGGATGTGGTGGAGAAAAAGAACATAATCGAGGCGACGCACATGTACGATAACGCTGCCGAGGCCTGCAGCACCACGGAGGAGGTGTTCAACTCCCCCCGGGCGGGCTCTCCGCTCTGCAACTCCAACCTGCAGGATTCGGAAGAGGACATCGAGCCCCCTTCCTACAGCCTGTTTCGAGAAGACACGTCGCTGCCCTCTCTGTCCAAAGACCATTCCAAGCTGTGTATGGAGCTGGAGGGGAACGATGGGCTGTCTTTCATCATGAGCAATTTTGAGAGTAAACTCAACAACAAAGTACCTCCGCCAGTCAAACCAAAGCCTCCTCTCCATTTTGATATTACAAAGGGGGATCTGTCTTACTTAGATCAAGGCCACAGAGATGGGCAGAGGAAGTCTGTGTCTTCTAGTACCTGGCTACCTCCGGACGCGTTCGATCCTTCCGATTACGCCGAACCCATGGATGCAGTGGCCAAGCCGAGAAATGAGGAAGAAAACATATACTCGGTGCCCCACGACAGCACCCAAGGCAAGATCATCACCATCCGGAACATCAACAAAGCCCAGTCCAACGGCAGTGGGAACGGTTCCGACAGTGAGATGGACACCAGCTCCCTAGAGCGAGGCCGCAAGGTATCCATCGTGAGCAAGCCAGTGCTGTACAGGACGAGATGCAGCCGGCTGGGGAGGTTCGCTAGCTACCGAACCAGCTTCAGCGTGGGGAGCGATGATGAGCTGGGGCCCATCCGGAAGAAAGAGGAGGATCAGGCGTCCCAAGGTTATAAAGGGGACAATGCCGTCATCCCGTATGAGACAGACGAAGACCCGAGGAGGAGGAACATCCTGCGCAGTCTGCGAAGGAACACCAAGAAACCAAAGCCCAAACCCCGGCCGTCCATCACGAAGGCAACCTGGGAGAGTAACTATTTTGGGGTCCCCTTAACGACCGTCGTGACTCCAGAGAAGCCAATCCCTATTTTTATTGAGAGGTGTATTGAGTACATTGAAGCCACAGGACTGAGCACCGAAGGCATCTACCGCGTCAGCGGGAACAAGTCGGAGATGGAGAGCCTGCAGAGGCAGTTCGATCAAGACCACAACCTGGACCTGGCGGAGAAGGACTTCACAGTGAACACGGTGGCTGGGGCCATGAAGAGCTTTTTCTCGGAACTGCCTGACCCCCTGGTCCCGTACAGCATGCAGACTGACCTGGTGGAGGCTCACAAAATCAACGACCGAGAGCAGAAGTTGCACGCCCTTAAGGAAGTACTCAAGAAATTTCCGAAGGAAAACCACGAAGTCTTCAAATATGTCATCTCGCACCTGAACAAAGTCAGCCACAACAACAAGGTGAACCTCATGACCAGTGAGAACCTCTCCATCTGCTTCTGGCCCACCCTGATGCGGCCGGACTTCAGCACCATGGACGCGCTCACGGCCACGCGCACCTACCAGACGATCATTGAGCTCTTCATCCAGCAGTGCCCCTTCTTCTTCTACAACCGGCCCATCAGCGAGCCCCCCGGCGCCACGCCCAGCTCCCCCTCCGCCCTGGCCTCCAGCGTGCCCTTCCTCACCTCCACACCGGTCACCGGTCAGCCGTCGCCCCCACAGTCGCCTCCACCCACCCCTCAGTCCCCGATGCAGCCCCTGCTCCCCTCCCAGCTTCAAGCCGAGCACACGCTGTGAGTCACCAAGGCCTGGGGCAAAAAGAGGCTCGATTTTCTCAGTCGGGGTGGCGTTTGGTCTTGAACACAACCAGGTCCACTGGGGCAGGGGTGGGGAGGCTGTCCCCTCCCCCTCTGTCACCTTCTCAAGATCTCAGCTGCAGCACCAGCCAGCGTCCACCATAGGCTGGGCCCGCGGCGCCCCGAGCCCAGCGCCGCAGACCTGGGGCTGACTGCGGGCAGCGGCTGGGGGCCCTGCCCTTGGACACGGACCCCTTCGAAGACTGACTGGCCAGGCGGCGGCCCCGGTGGCCGTCCACATGCTCGCTGTTCCGGGACTGCCTGCCCACGCACACCAGCTTCGGCGTCACCCACTGCCTGACAGAGCCCTGGCCTTTGCCAGGGGGAGGAGGTGGTTTTGATTCGGGCCACCCCTGGCAACCTCCGAGGAGACACTTCTCATCTGGCTCACCTGTCTCCCTACCTTCCACATCTGTTCCCACCCCCGTCGGCGGGGCGCCTGTCCAGCAGCCTCCTGGGGAACAGAGGCCACGGCGCTGCCGCCCCAAGGCACAGTGCCGAGGGCGTCTGCCCGGCCGCCCAGAACAGCTGGAGGGAGCTTTGTGCCTGGACCGAGAGAGTGTGACTCGTCCCTCCAGCCCCCGTGCTCCCTGTCCGCTGCATAGGCTTCGGGGACAGTTCCCTTCATGACAGAGGGACACTGGGAGAAAAGGAGGAAAACCTGTCCAGTAACTTGGAAAAACAAAAAGGAAGAAACTACAGACCTCAAGACTCAGCTCCCCCGCTTCTCAGGCCGACGGGCGCAAGGGGGCCCTGGTCTTTGTGACAGCAAAACCAGGAGGCCTGGCGGGCGGCTGCCTGAGAACTAGTTGGGGGTCCCACTCACGTCCTGTTATCAGGTCTGTGTTCCCCAAGAAGAGACGATTCGAGCCCTCGGTGGGTGGAGCTGGGGATTCGAGCAGACCAGCCTGGCACCTGGTCTGCCCTGGAACACTACAGGCTGTGGGGACACTGGGGGGAGGAGGACTGGAGTGGGGCCAGCTCAGGGCGCACTGGGGTTTCGTTTAGTGTGCTTGGTGTTGAAGCGGAATCGTTTCATTCTGGGGCACACTGTGCCACCAGCAGGGTGTGTGCGGGAAGAGGGCGGGGTAGGGAACTGAAGCACTGTGTCCTGCTGGTGTCCGCAGGGGCCATCCTTCATGCTCCCCAGGCCAGGAGATCCCAGAGGAGCCACATGCACAGAGGCCACCAGAGTCACAACACCTGCCTGTCTCACCCCACCCCCCTCCTGTGGCCTTGCCCACCCTTTCTGAGAAATGGCCTCCCCTCAGCTTCCTGGCCTTTCCACTGGCCCCTGGGAGAACCCTTCCCACGCCCCAGTACACACAGCAACCTGCTAAGGCTGCTACAGACCTTGGCTGCCCCCTACCCCTGGTGGCCGGGCTGTGGCCGCTGCAGTGGAGAAGCCTGACACTACGGTGCCCAGGGTGCAGGGTGTGGGGTGGAGGGCCCGCCCACCACACTGACCTCTGGGTCTCTGCACTTTAAGAAGTAGCACCTGGGTGTGTTTGAGGATGCCCTGGTCACCTCAGCTGGGTGGCCTGACAAATTAAGAGATGCCCCGAGGACTGTCCAGGTACCCCTAGCCCCAGACGCTGCCGGCTGGCTGTAGAGAGTGGGGCAGCCCTCGGCTCACGGGCTCCTTCCTCTGGATAAGCTGGATCCTTACCGTTCCTAGTTCGCGTACGGCAAAATAAGGTGCTTGGAAAAACTAAATTATCCCTGCAAGTTTTACCCTCCTTTTCAGGAACCCAAGTCAAAAAACACACCCGAGGTACATGACCGTTTTATGTAAACGTTGGGTGACGAGCGTTTCTCTGGTGGAGCTGTGCTTGATGGTTTAGGTCAGGGTGGGCTGCAGGGTGACGTTCTTGTTCAGTTTTGACAGAGGTTGGCAGACCCCCAGGCAGGAGAGGAAGTCGGTCCACTGAATTAATTTGTCCCTCGTTCTCACCTGCTTCGAGGCACTGCGTTTGAGTTGAAAGGGTGCCATGGGGGTGACCTGGGGCCACTGTCCTGGTGCGAACTGAAATAGCAGTATCCCAGTTCCCTCCCGCTGCCCAGGCTGCACTGCCACCCCCTCGGTGCTGGCGCCCTGGCCACAGCCCCACCCCGCTTGCAGCCTGGGCTCTGCACCAGGAGCTCAGAAGCCCCCAACAGGCCTGCCTGCCCACGGCACCCCACCCTGAGATGCAGCGTGTACGCGGCAGGGGGTTCTGGGCGTGTGGGGAGGAGCAGCAGTGCTCGGCGTCCTCCCCAGATAGAGGTTGCCTCCGGTCCCGCAGCGCACCCTGGCGGCCAGCTGGAGCAGCCATGGGCCCCCCTCACCTTCCCGTGTCCTGCCAAGGTTTTCGAGGTGCAGGCGGGGGGACCAGCAGCTCCCGTCCAGCCAGAGCTGCAGTGGGCAGGCGGCTTCGGGGTTCCTCTCGTTTCTGCTGCTTCCTCACGGACTCCGCTGCTGCTTTCAGCTGGCCCAGGCTAGGGGACGTGTCTTGGTCATTCTGAGTTGGCATCACCACTGGTAGTGCTGGGCCCCAGGTGTCCGCTTCCACTCGGGGGTCGGCGTTCAGACGAAGTGGGCGCTTGGGTGGAGGGCCACGAGAGCTGGGGCTCGCGTGGGACGCTTCCTTAAACACATGCTCCCCACGGCTCGAAGCTAAGAGCGGAGCGAGCACGAGCCGGCCTTGGCCAGGGGGCCGGCAGGGCGTGGCGGGCAGGGCTCTCCCCGTCTGGTGGTCTGTCTGGGTCCACGAGAGAGTAGGTGCCACGACAGCCATTGGCTGTAAGCTGAAGGCCAGTCCTGCCCTGTGGCACTGGTGCCGTGGAGGGCAGGGGCTGGGGTGGCTCGCAGGGTCGCCCTGAACCCCTGGCCGTGTCGGGCGTCACAGCATCCTGACGTGAGGGGCACGGAGAGAACTGGGCGGCACGGTCTCTGTGAGCCCCACCCCCGCTGCCGCCGTGGTTCCTCCTGTGTGGCAGGAAGTCTGCCGCCGGGTGATTCTTCCAGAGCAGGCGAAGTGAGCCCTGGTGGCCATGGTGGTTCCTCGCAGCAGCGCGCTGCCCAGAGGGCTCAGGAGCGTGCGCCTTCCCCGTCCGTGTTCCTGGCGCGTGGGGGGTGAACAAGGGTGCCCCAGCCTCGGCCCTGAGATTTGAAAACGAGCTGCAGCG