Transcript asmbl_26704

Sequence
Transcript Sequence for observation asmbl_26704 of TGE0004542:
AAAGGGTAAAGGAGCGACTCCAGCCCGCCGCTTCCTCAACTTGGGGCTCGCTGTCTCCGGCTCCGCTCGGGTAAGGGGCTCTGCAGCGACGTGCGCGGAGAGGGGCCACCGTGGGAAACTGGCCCCAGAAGAGCCAGGGCGGACTCCTGCTTCCAAGAGTCTCCGGCTTGTCGCTCCTCACGGCCCAGTGCCCCCTCCATCAGGTCCTCCAGCCAGAGGACAGGCATGGCGAGGCCGGGAGGCTCCTGCCTTTGCAGCTGTTTGGCTGTGCTCTGCCTCCTCCCCTCGCTGAGCCTGGCGCAGTACGAGAGCTGGCCCCACTACCCCGAGTACTTCCAGCAGCCGGCTCCCGAGTACCACCGGCCTCAGGTGCCCTCCGACGTCACCAAAATCCAGCTGCGCCTGGCGGGTCAGAAGAGGAAGCACAGCGAGGGGCGGGTGGAGGTGTACTACAACGGCGAGTGGGGCACCGTGTGCGACGACGACTTCTCCATCCACGCGGCGCACGTCGTCTGCCGGGAGCTGGGATACGTGGAGGCCAAGTCCTGGACCGCCAGCTCCTCCTATGGCAAGGGGGAAGGCCCCATCTGGTTGGACAATATCTACTGCACTGGCAAAGAGGCGACCCTTGCAGCCTGCTCCTCCAATGGCTGGGGTGTCACCGACTGCAAGCACACAGAAGACGTGGGTGTGGTGTGCAGTGACAAAAGGATTCCTGGGTTCAAATTCGACAATTCCTTGATCAACCACATAGAGAACCTGAACATCCAGGTGGAAGACATCCGCATCCGAGCCATCCTCTCCGCCTACCGAAAGCGCACCCCTGTGACGGAGGGCTACGTGGAAGTGAAGGACGGCAGGGCCTGGAAGCAGATCTGCGACAAGCACTGGACGGCCAAGAATTCCCGTGTGGTCTGCGGCATGTTTGGCTTCCCTGGGGTGAAGACGTACAACACCAAAGTGTACAAAATGTTTGCTGCCCGGAAGAAGCAGCGCTACTGGAGGTTCTCCATGGACTGCACGGGCACAGAGGCCCACGTCTCCAGCTGCAAGCTGGGCCCTCGGGTGTCCCGGGACCCCGTGAAGAACATCACCTGTGAGAATGGGCTGCCGGCTGTGGTGAGCTGTGTGCCTGGCCAGGTCTTCAGCCCTGATGGACCCTCAAGATTCCGGAAAGCTTACAAGCCAGAGCAACCCCTGGTGCGGTTGAGAGGTGGTGCCAACGTCGGGGAGGGCCGCGTGGAGGTACTCAAGAATGGAGAATGGGGTACCATCTGTGACGACAAGTGGGACCTGGTGTCTGCCAGCGTGGTCTGCAGAGAGCTGGGCTTTGGGAGTGCCAAAGAAGCCATCACTGGCTCCCAGCTGGGGCAAGGGATAGGACCCATCCATCTCAATGAAATTGAGTGCACGGGGAATGAAAAGTCCATCATAGACTGCAAATTCAATGCTGAGTCTCAGGGCTGCAACCATGAGGAAGATGCTGGTGTGAGATGTAATATCCCCGCCATGGGCTTCCAGAAGAAGCTGCGCCTGAACGGGGGCCGAAACCCCTACGAGGGCCGGGTGGAGGTGCTGGTGGAGAGGAACGGGTCCCTCATATGGGGGACGGTGTGTGGCGAGAACTGGGGCATTGTGGAGGCCATGGTGGTCTGCCGGCAGCTGGGCCTGGGGTTCGCCAGCAGCGCTTTCCAGGAGACCTGGTATTGGCACGAAAACATCAATGCCAATAAAGTGGCCATGAGCGGAGTGAAGTGCTCTGGAACGGAGCTGTCCCTGGAACACTGTCGCCATGACGAGGATGTGGCTTGCCCCCAGGGCGGAATGCAGTACGGAGCTGGAGTCGCCTGCTCAGAAACCGCCCCTGACCTGGTCCTCAATGCGGAGATCGTCCAGCAGAGCACCTACCTGGAGGACCGACCCATGTTCATGCTGCAGTGCGCCATGGAGGAGAACTGCCTCTCGGCCTCGGCCGCCCAGACCAACCCCACCTCAGGCTACCGGCGGCTGCTTCGCTTCTCCTCCCAGATCCACAACAATGGCCAGTCCGACTTCCGGCCCAAGAACGGCCGCCATGCGTGGATCTGGCATGACTGCCACAGGCACTACCACAGCATGGAAGTGTTCACCCACTATGACCTCTTGAACCTCAATGGCACCAAGGTGGCAGAGGGCCACAAAGCCAGCTTCTGCTTGGAGGACACAGAATGTGAAGGAGATAGCCAGAAGAGCTACGAGTGTGCCAACTTTGGTGAGCAGGGCATCACCATGGGCTGCTGGGACGTGTACCGCCATGACATCGACTGCCAGTGGGTGGACATCACAGATGTGCCTCCCGGAGACTACTTGTTCCAGGTTGTCATCAACCCCAACTATGAGGTTGCAGAATCTGACTACACCAACAACATCATGAAATGCAGGACCCGCTACGACGGCCACCGCATCTGGATGTACAACTGTCACATAGGTGGTTCCTTCAGTGAAGAGACAGAAAAGAAGTTTGAACACTTCAGTGGACTCATAAATAACCAGCTCTCTACGCGGTAAGGCAGCCTACATGGTCACGTGGTCACCTCCTGCCTTTGGGCCACAGCGCATCTTCCCCAACAACTGCAGTCCGACGGACGATCACCACACTCCCCCTCGCCTAGCCCGGCCCCGCCCCATCTGGATACCCTGCGGCCACATCTCAGCTCAAGAGGAATGGGTGTTCCTGACATTTGCTGGGGGCTGCTGCCTGAGCCTGGGAAGGTGTCTGGGAGTGGGCCTTGTCCGCAGGGCTGTGGGAGCAGTGCCACGGGCCATCTTGTCCGGGACCCCAGGCACACAGGTTGTCATCAGCTTGTCCCATCCAAACCAGTCACACCTGCCCCACACCCCACCCCATCCCCAGTCTGACACCACCCCCATCAGCTCACCACAGATAATATGGGGCCATTCTCTCCTCAAATTCCATGTCGGCAAAGCCAGTTTATCGCCCGAGGTGGTCAGGCTGAATCCCATTTCTCCTCCTCTTGGGTCATCTGCAACCAACTTGAACGTCTAGAGCTCTCTTCCAGTTAAACGAACTGCCTGTCCTCTCCTCTCTCTGTTCACGTATATAAAAAATGCTGCCACATTTTCTGATGAAGTGAGCTCAGAGCTGGTACTTCTCCCCTACCCTCAACTCTACATCCTATTTTTCAAGATACCATTATTATATTTTCACGAACTTTGAAACACAAATTAATTTAGTGGCATTTAATATTGGGCATCTGGGCCTTTGGAAGGAAAAACCTGCCCACCTGTGTAAGTGACTCATGGTTCTGTTGTTCTGATTCTGTGGGTAACTGATTCAACGGTGCTATAACCAGGGTCCTGGGTGACAAGGACACTCACCAAACGCCATGTGTCATCACAGACACTTACACATACTTGAAACTTGGAATAAAAGATTTATGATTTGTA