Transcript asmbl_25884

Sequence
Transcript Sequence for observation asmbl_25884 of TGE0004497:
AGGTAAGGGACCTGGAAACCAAGAAGTGACTGCTCATCTAATCCGCTAAAGCTATGTTAGCAGATTGGAGCTGTTTGCAGACAAAGTTCCAAAGACAGCAGAAAACTTTCGTGCTCTGAGTACTGGGGAGAAAGGATTTGGTTATAAAGGTTCCTGCTTTCACAGAATTATTCCAGGATTTATGTGCCAGGGTGGTGACTTCACACGCCATAATGGCACAGGTGGCAAGTCCATCTATGGGGAGAAATTTGATGATGAGAATTTCATCCTGAAGCATACAGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAATACAAACGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAATGGTTGGATGGCAAGCATGTGGTCTTCGGCAAGGTGAAAGAGGGCATGAATATTGTGGAGGCCATGGAGCGTTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCTAATAAATTTGACTTGTTTTATCTTAACCACCAGACCATTCCTTCTGTAGCTTGCGAGAGCACCCCTCATCCCGCCTGCTCGGAACACCCTGTTATAATCGGCTCTCGCTGCGGTTCTTTGGGTTCCGGGTTTTCCTTGTACCTCCACGTCTAGCTGGGTTGCAGAGTTAAGTTTATGATTATGAAATAAAAGTTAAACAACAGTTGTCTGTCCTTGTTTGGGTTAGGGTGTTGATGTAGGCTTCATTTTAAGCAGCAGCAGGTTCTAAGCCACGTGCTATGTTTGCTTAATTCCACAGAGTACTGTGTTTTGCTTCCCTGACCCAAGAATTAAATGTCACTGAGTATCTTCAAGGTAATCTGAGTGGAATACCGAAGGTGAAACGGGGACCAGGTTGGGCCAGTGCTCCTTGAAGAAAGTCCCACTTGGCATGTTCAGAGGTATCTATTAAAATTAATGTTATAACAAGTTGAAAACCATGGCTTGTTTTAGCAAAGATTAATTTGAG