Transcript asmbl_25863

Sequence
Transcript Sequence for observation asmbl_25863 of TGE0015330:
CAGAAGTTGCCCAAGGACCCTCCCTGTCTTCTGTGGTGGCCGTTGTCCCTCCCTGGGACATGAAGCCACTGGTGGGAGCGCAACAGCTTTGGGGAACTGGCGGGTCATGCCCAGTGTTGTATTGCAGACGGGCGAGGGCGTGAATGACGTGCGGAAGGGAGCGTGTGCCAGCCACGTCAGCACCATGGCCGGCTTCCTGAAGGGGGCCCACGTCACCATCAACGCAAGGGCTGAGGAGGACGTGGAGCCCGAGTGCATCATGCAGAAGGTGGCCAGGGCCTCTGGCGCCAACTATACCTTCCACAGGGAGAGCGGCCGCTTCCAGGACACAGGCCCCCAGGCCCCAGTGGGCTCTGTGTACCAGAAGACCAATGCGGTGTCTGAGATCAAGAGGGTCGGCAAAGACAGCTTCTGGGCCAAAGCGGAGAAGGAGGAGGAGAACCGCAGGCTGGAGGAGAAGCGGCGGGCGGAGCAGGAGCGCCAGCGGCTGGAGGAGGAGCGCCGGGAGCGGGAGCTGCGCGAGGCTGCCCGCCGGGAGCAGCGCTACCAGGAGCAGAGCGCCGGCGGCGAGGCCAGCCTGCAGAGGAAGTGTGAGCAGCAGGACGTGGCTCTGAGGAACAGAGAGGAGCAGGAGCCCGTCTGCCAGCAGTCAGCACACCCAAGGGAGGTTTTCAGGCAGAAGGAGAGAGCCACGTCCACCACACTCGTCTCCAGCTGCCAGCCAGGCAAACTGAAGAGCCCCTTCCTGCAGAAGCAGCTCACCCAGCCTGAGCTCCCCCTCGGCGGAGAACTGCACGCCACCTCAAGGCCCCGGGCAGGTCTCCATGAGCAGTCAGCAGCCAGCGCCCCAACCTGTCCAGCACAAGCTGGAGAGGAGGCTGTGTATGAGGAGCCCCCAGTGCAGGACGCCCTCTATGAGGAGCCCCCTATGGTGCAGCCGCAGGACGCTGGCGCTGAGCATGTGGATAGCTACCCGGAGCTGAGTGGGAAGGGGCTGTGTGCCCGGGCGCTGTACGACTACCAGGCAGCTGACGAGACCGAGATCTCCTTTGACCCCGAGAACCTCATCACGGGCATCGAGGTGATTGACGAGGGCTGGTGGCGTGGCTACGGGCCGGACGGCCGCTTCGGCATGTTCCCTGCCAACTACGTGGAGCTGATGCAGTGAGGGCCCCGCGCTGCTGGCGGAGGCTCAGGGCCACCCTTCCCTCCCCCCACACGTGTCTTGCTGGAAGTGGGGTGAGAGTTGCACACAGCGCTCTTCCAGGAGTGGGACCCCGGGGAGAACAGGCCCTTGGGCTCCCTCTGGCTCAAGTAGCTTGGCCTCTATCACCCCAAATGCAGCAATAACCCAGTGATTCCTACACATGCTTCCGGCAGCCTCCCAGGCCTCCAGTCAGTACAGCTCTTGACCCCAATAAAGGACATTGAGTCAGGCCTCACCCATGCCAGCCCCTGGGGATGTCTGAGCAGTGGCATCTGGTGG