Transcript asmbl_25675

Sequence
Transcript Sequence for observation asmbl_25675 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTAGCTGTGTTTGAGATGAAAATCTGGGGCCAGAGCGGGGCACAGAGGGGAACGGAGGCTGTTGGCCTGGCTTGCTTCAGCAGCTGACCTGGGGAGGCCACAGCGTGTGTG