Transcript asmbl_25396

Sequence
Transcript Sequence for observation asmbl_25396 of TGE0004449:
TCGGGAAGACGGTTGTTTCACGGATCCGGTAACCAGCCTGTCCTTTTTCCCCTCCCCACTCCCCTTTTCCCCTGTCCCGACCCGGCTTCTTTGTGTCTCCGCGCGGCGGCAGATTTCAACACTAAACTTGCACAATGTCTTTGAAACCAAGAGTAGTAGATTTTGATGAAACATGGAACAAACTTTTAACGACAATCAAAGCTGTTGTCATGTTGGAATACGTCGAAAGAGCAACATGGAACGATCGCTTCTCAGATATCTATGCTTTATGTGTGGCCTATCCTGAACCCCTTGGAGAAAGACTTTATACAGAAACTAAAATTTTTTTGGAAAATCACGTACGGCATTTGCACAAGAGAGTTCTGGAATCCGAAGAGCAAGTACTTGTTATGTATCATAGGTATTGGGAGGAATATAGCAAGGGTGCAGACTATATGGACTGCTTGTATAGGTATCTCAACACCCAATTTATTAAAAAGAATAAATTGACAGAAGCTGACCTTCAGTATGGCTATGGTGGTGTAGATATGAATGAACCACTTATGGAAATAGGAGAGCTAGCATTGGATATGTGGAGGAAATTGATGGTTGAACCACTTCAGACCATCCTTATCCGAATGCTGCTCCGAGAAATCAAAAATGATCGTGGTGGAGAAGACCCAAACCAGAAAGTAATCCACGGGGTTATTAACTCCTTTGTTCATGTTGAACAGTATAAGAAAAAATTCCCCTTAAAGTTTTATCAGGAAATCTTTGAGTCTCCCTTTCTGACTGAAACAGGAGAGTATTACAAACAAGAAGCTTCAAATTTATTACAAGAATCAAACTGCTCACAGTATATGGAAAAGGTTCTAGGTAGATTAAAAGATGAAGAAATTCGATGTCGAAAATACTTGCATCCAAGTTCATATACTAAAGTGATTCATGAGTGTCAGCAACGAATGGTAGCAGACCACTTACAGTTCTTACATGCAGAATGTCATAATATCATTCGACAAGAGAAAAAAAATGACATGGCAAATATGTATGTCTTACTCCGTGCTGTGTCCACTGGTTTACCTCATATGATTCAGGAGCTGCAAAACCATATCCATGATGAGGGCCTTAGAGCAACCAGTAATCTTACTCAGGAAAATATGCCAACACTATTTGTGGAGTCAGTTTTGGAAGTACATGGTAAATTTGTTCAACTTATCAACACTGTTTTGAATGGTGATCAGCACTTTATGAGTGCATTGGATAAGGCCCTCACATCAGTTGTAAATTACAGAGAACCCAAGTCTGTTTGCAAAGCTCCTGAATTGCTTGCTAAGTACTGTGACAACTTACTAAAGAAATCAGCGAAGGGGATGACTGAGAATGAAGTGGAAGACAAACTCACCAGCTTCATTACTGTTTTCAAATACATTGATGATAAGGATGTTTTTCAAAAGTTCTACGCAAGAATGCTGGCAAAACGTTTAATTCACGGGTTATCTATGTCTATGGATTCTGAAGAAGCCATGATCAATAAATTAAAGCAAGCCTGTGGTTATGAGTTTACCAGCAAGCTACATCGGATGTATACAGATATGAGTGTCAGTGCTGACCTTAACAATAAGTTCAACAATTTTATCAAAAATCAAGACACTGTTATAGATTTGGGGATTAGTTTTCAAATATATGTTCTACAGGCTGGCGCATGGCCTCTTACTCAGGCTCCTTCATCTACATTTGCAATTCCCCAGGAATTGGAAAAAAGTGTACAGATGTTTGAATTATTTTACAGCCAGCATTTCAGTGGAAGGAAACTTACGTGGTTACATTATCTCTGTACAGGTGAAGTTAAAATGAACTATTTGGGCAAACCATATGTAGCCATGGTTACAACATACCAAATGGCAGTTCTTCTAGCCTTTAACAACAGTGAAACTGTCAGCTATAAAGAGCTTCAAGACAGCACTCAGATGAATGAAAAGGAACTGACAAAAACAATCAAATCATTACTTGATGTGAAAATGATTAACCATGATTCAGAAAAGGAAGATATCGATGCAGAATCTTCATTTTCATTAAATATGAACTTCAGCAGTAAAAGAACAAAATTTAAAATTACTACATCGATGCAGAAAGACACACCACAGGAAATGGAACAGACTAGAAGTGCTGTAGATGAGGACCGGAAAATGTATCTCCAAGCTGCTATAGTTCGTATCATGAAAGCACGAAAAGTACTTCGGCATAATGCTCTTATTCAAGAGGTGATTAGCCAGTCAAGAGCTAGGTTTAATCCTAGTATCAGCATGATTAAGAAGTGTATTGAAGTGCTGATAGACAAACAGTACATTGAACGCAGCCAAGCATCAGCAGATGAATACAGTTACGTAGCGTGATGTCGCTCTCCTCCTGTGTGATGTGAGAAGATCATTGCCATCACCATTTGGCGTGTTCCTGTGGGAAAAAGCAGGCCTGTGCCTCCATAATTTGGTCATTTGGCAGCCCCTGTTTTTCTGCTGTTTACAACATCACCAGTGCCACGTCATGAGCGTCAGAGAAAATGCCTAGAGATATTTCAAGCTCATGTCATTATGACATTTCTTAAAACTTTATTAAAAGAATGAGTGAAGTATTGCTGACATGTGGAAATTTGGTTGGGTACCATGCTTTTTCTCCCCTTCACGTTTGCAGTTGATGTGTTTTTTTTTTAATGTATCTTAAAGGACATAAAATAAAAACTTAAATATTGTAATATGACAGATAACCTTAATAATTGTATCTACATTAAAATGACAAACATGATATTGCTGCTTGTCAAATAAAAAAATAAAGAAGTAGAATGCCTT