Transcript asmbl_2502

Sequence
Transcript Sequence for observation asmbl_2502 of TGE0004434:
CTTTTATAAAGGGCCACGCTGTCCCCCACTTGGAAGCAGCTTTTTGGCTCCTCCAGAGTCTGTCAGTTTCGGCTCCTCGCCTTCACTCCAGCCTCCAACATGTCCGTGAGGGTGACCCAGAAGACCTACAAGATGTCCACCTCTGGTCCTCGGGCCTTCAGCAGCCGCTCGTACTCGAGTGCTCCCGGTTCCCGTATCAGCTCCTCGGCCTTTTCCCGGGTGGGCAGCTACCGGGCTGGCCTAGGCATCAACATGAACCTGGCTGGGGGTTACGGCGGAGCTGGAGGTGCGGGGAACATCACAGCAGTCCAAGTGAACCAGAGCTTGCTGAGCCCCCTGAAGCTGGAGGTGGACCCCAACATCCAGGCCGTGCGCACCCAGGAGAAGGAGCAGATCAAGACCCTCAACAACAAGTTTGCTAACTTCATCGACAAGGTACGGAGCCTGGAGCAGCAAAACAAGATTCTGGAGACCAAGTGGAACTTTCTGCAGCAGCAGAAGACGATTCGCAGCAACATGGACAACATGTTTGAGAGCTACATCAACAACCTTCGACGGCAGCTGGACACGCTGGCCCAGGAGAAACTGAGGCTAGAGGCAGAGTGTGGCAACATGCAGGGGCTGGTGGAAGACTTGAAGAATAAGTATGAGGATGAGATCAACAAGCGCACAGAGATGGAGAATGAATTTGTCCTTATCAAGAAGGATGTGGATGAAGCTTACATGAACAAGGTAGAGCTGGAGTCTCGCCTGGAAGGGCTAACCGATGAGATCAACTTCTATAGGCAGCTGTATGAAGAGGAGATCCGTGAGCTGCAGGCCCAGATCTCTGACACGTCCGTGGTGCTGTCCATGGACAACAACCGCTCCCTGGACCTAGATGGCATCATCGCCGAGGTCAAGGCCCAGTACGAGGACATCGCCAACCGTAGCCGGGCTGAGGCTGAGACCATGTACCAGATCAAGTATGAGGAGCTGCAGACGTTGGCTGGGAAGCATGGAGATGACCTGCGTCGCACAAAGACAGAGATTTCTGAGATGAACCGGAACATCAGCCGACTCCAGGCTGAAATCGAGGCCCTCAAAGGCCAGAGGGCTTCCCTGGAGGCCGCCATCGCTGATGCCGAGCAGCGTGGGGAGCTGGCCCTCAAGGATGCTCAGGCCAAGGTGGCTGAGTTGGAGGCTGCTTTGAGAAATGCCAAGCAAGACATGGCCCGGCAGCTGCGCGAGTACCAGGAGCTCATGAACGTCAAGCTGGCCCTGGATGTGGAGATCGCCACCTACCGCAAACTGCTGGAGGGCGAGGAGAGCCGGCTGGAGTCTGGGATGCAGAACATGAGTATCCATACCAAGACTACCAGTGGCTACTCAGGTGGGCTGAGCCCGGCCTATGGAAACCTCACAAGTCCTGGCCTCAACTACGGTGTCAGCTTCCAGTCCAACTTCGGCTCTGGGGGGAGTTCCGGCTCTTTCAGCCGCACCAGCTCCACCAAGACCGTGGTGGTGAAGAAGATCGAGACTCGTGATGGGAAGCTTGTATCTGAGTCATCTGATGTCCTGCCTAAGTAAATGGCTACCGTGGTCCCTCTTGGCCTTTCAAGCCTGTGGGAAAGGAGCTGTGCAGAGAGCCTTGAACACAGGAGACCCACCTGAAGCTCAGCCCCAGTTCTCAGCCCCAACCCTGGGTGGGGAATCTACTGCCTGGAGGACCGCCTCTTACCCACGCCCCTAACTAAAAGCCAAATCAAGTGTTTTTTCCAAAATAAAGTCTCAGCTGGCTCTGCCAACCTT