Transcript asmbl_24470

Sequence
Transcript Sequence for observation asmbl_24470 of TGE0004418:
ATAGGGTCTGGACTTTGCGTAAAGGGACGGATGGAAATTGAAGAACGGAGATGGGGACCAGGAGGGAGGGAAGGACTGGGGGTGAGCAAAGGGGCGGGGCCCTGGCTGCTGTGGCCTCCCCTGACCCCCTCCCCCCGCTGCTGGGGTCCTCGGGCAAGCCCCCTTCTCACTGGACTGAGACATGAGGCTGAACTGGGTCCTGACAATACTGTCCATCTGCCTGAGCGCCCTGGCCACGGCCGCAGGGGCCGAGGGCAAACGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTAGACCACTGTCCCATCAAATCGCGCAAGGGGGACGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAATTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTGGGCACGGGCCAGGTCATCAAGGGTTGGGACCAGGGGCTGCTGGGGATGTGTGAAGGGGAAAAGCGGAAGCTGGTGATTCCATCAGAGTTGGGATATGGAGAGCGGGGAGCCCCGCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAACTGCTCAAAATCGAGCGACGTTCAGAACTGTAGCAAAGCTGGGGAGGGGCAGCGGAGAGGCCATCAGGGACCAGACTGTTTAAAAGAAAAACAAAAACA