Transcript asmbl_24430

Sequence
Transcript Sequence for observation asmbl_24430 of TGE0015267:
CGCAGGAGGAGGGCGGGGAGGAGCGCTCTTCCTGGTTGGGCCCTGCCCTGAGCTGCCACCCGGGAAGCCAGCCTCAGGGACCGCAGCGATCCCCTAAACACTCCTCCAGGATGGCTGAGGAGTTTATCACCCCTGTGTACTGCACCGGGGTGTCTGCACAAGTGCAGAAGCTGCGGGCCAAGGAGCTGGGCCTGGGCCGCCATGAAAACGCTATCAAGTACCTGGGCCAGGATTACGAACAGCTGCGGGCTCAGTGTCTGCAGAGTGGGACCCTCTTCCGGGATGATGCCTTCCCCCCAGTGCCCCAGAGCCTGGGCTACAAGGACCTGGGCCCCAACTCCTCCAAAATCTATGGCATCAAGTGGAAGCGTCCCACGGAGCTGCTCTCCAACCCCCAGTTCATCGTGGATGGAGCCACCCGCACAGACATCTGCCAGGGAGCACTGGGGGACTGCTGGCTCCTGGCTGCCATCGCCTCTCTTACCCTCAATGACACCCTCCTGCACCGAGTGGTTCCGCATGGCCAAAGCTTCCAGGATGGCTACGCTGGCATCTTCCATTTCCAGCTGTGGCAGTTTGGGGAGTGGGTGGACGTCGTCGTGGATGACCTGCTGCCCATCAAGGACGGGAAGCTGGTGTTCGTGCACTCTGCCCAAGGCAATGAGTTCTGGAGCGCCCTGCTCGAGAAGGCCTATGCCAAGGTAAATGGCAGCTACGAGGCCCTATCAGGTGGCAGCACCTCGGAGGGCTTTGAGGACTTCACAGGCGGTGTCACCGAGTGGTATGAGCTGCGCAAGGCGCCCAGCGACCTCTACCAAATCATCCTCAAGGCGCTGGAGCGGGGCTCCTTGCTGGGCTGCTCCATTGACATCTCCAGTGTTCTAGACATGGAAGCCGTCACCTTCAAGAAGCTGGTGAAGGGCCACGCTTATTCTGTGACTGGGGCCAAGCAGGTGAACTACCAGGGCCAGATGGTGAGCCTGATCCGGATGCGGAACCCGTGGGGCGAGGTGGAGTGGACAGGAGCCTGGAGTGACCGCTCCTCGGAGTGGAACAATGTGGACCCTTATGAACGCGAGCAGCTCCGGATCAAGATGGAGGACGGGGAGTTCTGGATGTCATTCCGAGACTTCATGCGCGAGTTCACCCGCCTGGAGATCTGCAACCTGA