Transcript asmbl_24284

Sequence
Transcript Sequence for observation asmbl_24284 of TGE0004390:
AGGAATGGGACAAGATGACACAGTGCCACTGAGGTCAAGGGTCAGGGCTCCTGCAGTGTCAGAGTCCTGGGGGGCCGGGTCTGGGACCCACCGCACCTCCCGTGCTTTTCATGCTGACAGATGCGCTGCCTGACTACACCCACGCTGCTTCGGGCCCTGGTCCAGGCCGCACACACAGGGCATTCTAGTGGCCGGAGCCTGCACAGCGGCGCAGTGGCAGCCACCTATAAGTACGTGAACGCGCAAGAGCCCTCCATGGACATGAAGTCGGTGACTGACCGGGCAGCTCAGACCCTGCTGTGGACGGAGCTCATCCGAGGCCTGGGCATGACCCTGAGCTACCTGTTCCGGGAGCCAGCCACCATCAACTACCCGTTTGAGAAGGGCCCGCTGAGCCCGCGTTTCCGCGGGGAGCACGCGCTGCGCCGTTACCCATCCGGGGAGGAGCGCTGTATCGCCTGCAAGCTTTGCGAGGCCGTCTGCCCCGCCCAGGCCATCACCATCGAAGCCGAGCCTCGGGCTGACGGCAGCCGCCGGACCACCCGCTACGACATCGACATGACCAAGTGCATCTACTGTGGCTTCTGCCAGGAGGCCTGCCCCGTGGACGCCATCGTCGAGGGCCCTAACTTCGAGTTCTCCACGGAGACGCATGAGGAGCTGCTGTACAACAAGGAGAAGCTGCTGAACAATGGGGACAAGTGGGAGGCTGAGATCGCTGCCAACATCCAGGCCGACTACCTCTACCGGTGACACTCCTGCCCGGCTGGCCCGCAGCCCCTGCTGCCCAATAAAGAAGCTCTGCTCTCCC