Transcript asmbl_24166

Sequence
Transcript Sequence for observation asmbl_24166 of TGE0004373:
GTTTCCGTTAGGTACAGGAGGCTGAGGCGCGCGACCCGCCGCAGTCCCACGTGAAGGGCTACGCGAGCATCGCTCGGCGGGACAGCTCCCCGCTCGCCGCGGAGCGTCCCGGAAGCAGCGGGGAACCGGAAGTGGCCCGCGGCAGCTCAGAAGCTGATCCCGGTTCCCGGTGTGTGGCCCCTCGAAGCGCAGCGACGGCGCCATGTCCCTGATCTGCTCGATCTCCAATGAAGTGCCAGAGCACCCGTGTGTGTCCCCTGTCTCTAATCATGTCTATGAGCGGCGGCTCATTGAAAAGTATATTGCAGAGAATGGCACAGACCCCATCAACAACCAGCCTCTGTCCGAAGAGCAGCTCATCGACATCAAAGTTGCTCACCCAATCCGGCCCAAGCCTCCCTCAGCCACCAGCATCCCGGCCATTCTGAAAGCCTTACAGGACGAGTGGGATGCAGTTATGCTGCACAGCTTCACTCTGCGCCAGCAGCTGCAGACAACCCGCCAAGAGCTGTCCCACGCGCTGTACCAGCACGACGCCGCCTGCCGTGTCATTGCCCGTCTCACCAAGGAAGTCACTGCTGCCAGAGAAGCTCTGGCTACCCTGAAACCGCAGGCTGGTCTCATCGTGCCCCAGGCTGTGCCGAGTTCACAGCCAAGTGTTGTGGGTGCAGGCGAGCCCATGGATTTGGGTGAACTGGTGGGAATGACTCCCGAGATCATACAGAAGCTCCAAGATAAGGCCACTGTGCTGACCACGGAGCGTAAGAAGAGAGGGAAGACTGTGCCTGAGGAGCTGGTGAAGCCAGAAGAGCTTAGCAAATACCGTCAGGTGGCATCGCACGTGGGCTTGCACAGTGCCAGCATTCCCGGGATCCTCGCCCTGGACCTCTGCCCCTCCGACACCAACAAGATCCTCACTGGTGGGGCGGATAAAAACGTCGTCGTCTTTGACAAGAGTTCTGAGCAGATCCTGGCCACCCTCAAGGGCCACACCAAGAAAGTCACCAGTGTGGTGTTTCACCCTTCCCAGGAGCTGGTGTTTTCTGCCTCCCCAGATGCCACTATCAGGATTTGGTCTGTCCCGAACGCCTCTTGTGTACAGGTTGTTCGGGCCCATGAGAGCTCTGTGACCGGCCTCAGCCTCCACGCCACTGGCGACTATCTCCTGAGCTCCTCTGATGACCAGTACTGGGCCTTCTCTGACATCCAGACAGGGCGTGTACTCACCAAGGTGACAGATGAGACCTCTGGCTGCTCTCTCACCTGTGCGCAGTTCCATCCCGATGGGCTCATTTTTGGAACGGGAACCATGGACTCTCAGATCAAGATCTGGGACTTAAAGGAGCGCACCAACGTGGCCAACTTCCCTGGCCACTCGGGCCCCATCACCAGCATTGCCTTCTCCGAGAATGGCTACTACCTGGCCACCGCGGCCGACGACTCCTCTGTCAAGCTCTGGGATCTGCGCAAGCTTAAGAACTTTAAGACACTGCAGCTGGACAACAACTTTGAGGTGAAGTCGCTGATCTTTGACCAGAGCGGTACCTACCTGGCCCTTGGGGGCACAGATGTCCAGATCTACATCTGCAAACAGTGGACGGAGATTCTTCACTTCACAGAGCACAGCGGCCTGACCACAGGGGTGGCCTTTGGGCACCACGCCAAGTTCATCGCTTCCACGGGCATGGATAGGAGCCTCAAGTTCTACAGCCTGTAGGCCCTGTCCCCTCTGACGCAAGCTGAACCTCATCTCAGTAGTGGGGTAGAGTTAGGGTTG