Transcript asmbl_23952

Sequence
Transcript Sequence for observation asmbl_23952 of TGE0004335:
GACATGTCCTTCCGAAAAGTGGTTCGGCAGAGCAAATTCCGGCATGTGTTTGGGCAGCCGGTCAAGAATGACCAGTGTTATGAGGACATCCGAGTGTCCCGTGTCACCTGGGACAGCACCTTCTGCGCTGTCAACCCCAAGTTCCTGGCAGTGATTGTGGAGGCCAGTGGTGGAGGCGCCTTCCTGGTGCTCCCTCTAAACAAGACGGGCCGCATTGACAAGGCCTACCCAACGGTGTGTGGGCACACGGGACCTGTCCTGGACATCGACTGGTGTCCCCACAACGACGAAGTCATCGCCAGCGGCTCGGAGGACTGCACAGTCATGGTGTGGCAGATCCCAGAGAATGGGCTGGCCTCCCCGCTGACAGAGCCCGTGGTGGTGCTGGAGGGGCACACCAAGCGAGTGGGCATCGTCACCTGGCACCCGACGGCCCGCAATGTGCTGCTCAGCGCAGGCTGTGACAATGTGGTGCTCATCTGGAACGTGGGCACGGCGGAGGAGCTGTACCGCTTGGACAGCCTGCACCCCGACCTCATCTACAATGTCAGCTGGAACCGCAACGGCAGCCTCTTCTGCTCCGCCTGCAAGGACAAGAGCGTGCGCATCATCGACCCCCGCCGGGGCATCCTGGTGGCGGAGCGAGAGAAGGCTCACGAGGGCGCCCGGCCCATGCGGGCCATCTTCCTGGCGGATGGCAAGGTGTTCACCACCGGCTTCAGCCGCATGAGCGAGCGGCAGCTGGCGCTCTGGGACCCAGAGAACCTCGAGGAACCAATGGCCCTGCAGGAGCTGGACTCTAGCAACGGGGCTCTGCTGCCCTTTTACGACCCTGACACCAGCGTGGTCTACGTCTGTGGCAAGGGCGATTCCAGCATCCGGTACTTTGAGATCACAGATGAGCCCCCCTACATCCACTTCCTGAACACGTTCACCAGCAAGGAGCCCCAGAGGGGCATGGGCAGCATGCCCAAGAGGGGCCTGGAGGTCAGCAAGTGCGAGATCGCCCGATTCTACAAACTGCACGAGCGCAAGTGCGAGCCTATTGTCATGACTGTGCCAAGAAAGTCGGACCTCTTCCAGGATGACCTGTACCCTGATACGGCCGGGCCCGAGGCGGCCCTGGAGGCAGAGGAGTGGGTGAGCGGGCGGGACGCCGACCCCATCCTCATCTCCCTGCGGGAGGCCTACGTGCCCAGCAAACAGCGGGACCTGAAGGTCAGCCGGCGGAACGTGTTGTCTGACAGCCGGCCTGCTGTGGCCCCGGGCTCCGCGCGCCTGGCGGCCTCCACACCTGCCACCTCCACCCATACGACTGCCCCCAGCAGCAGCCTCGCTGGGGCCGGGGAGGCTGGGAAACTGGAGGAGGTGATGCGGGAGCTGCGGGCACTGAGAGCGCTGGTCAAGGAGCAAGGGGAGCGCATCGGCCGCCTGGAGGAGCAGCTGGGCCGCATGGAGAATGGGGACGCCTAGGACCATAGGCCCAGTGGATGCCACGCCCCCTCACCTCCTCCTCCTCCACCCACTTCTCACTCAGCCTCTGCTGGCAGGCCACACCGATAGCTGGCTGCCCCCTGCCCCCTGCCCCCTGCCGAGGGCCTCTGGGGCAGGCTCGGGGCCAGCCCACACCCTGATCCATCCTGTGGGCCAGGCTGGAGCCACCGCCTGGCTTTTGTCTTTGTTACTGTGGAGGATTTTTGTACCAAGGCGAGCTTATGTGAGGGACCCTCTCTCCACACGCCCACCCGCCCCCTGCTCCCTCCCGGAGGAGTGGGAGGGATGGGCTCTATATTTTCA