Transcript asmbl_13625

Sequence
Transcript Sequence for observation asmbl_13625 of TGE0000183:
CGGACTGGACGGGAACCTGGCGGGGTCAGGTCCCGTCAAGCAGCCTGGCTCATGGCTGTGTGCGGCCTGGGGAGCCGTCTTGGCCTGGGGAGCCGTCTTGGCCTGCGCGGGTGCTTCGGCGCCGCCAGGCTCCTGTATCCCCGTTTCCAGAGCCGCGGCCCTCAGGGCGTGGAAGACGGGGACAGGCCACAGCCTTCCTCGAAGACACCCAGGATCCCCAAGATTTACACCAAAACGGGAGACAAAGGGTTTTCTAGTACCTTCACAGGAGAAAGGAGACCCAAAGATGACCAAGTGTTTGAAGCCGTGGGAACTACAGATGAATTAAGTTCAGCTATTGGGTTTGCTCTGGAATTAGTCACAGAAAAGGGCCATACATTTGCCGAAGAGCTTCAGAAAATCCAGTGCACATTGCAGGACGTCGGCTCGGCCCTGGCGACACCATGCTCCTCGGCCCGGGAGGCTCACTTAAAGTATACCACGTTCAAGGCGGGGCCCATCCTGGAGCTGGAGCAGTGGATCGACAAGTACACCAGCCAGCTCCCACCACTCACGGCCTTCATCCTGCCTTGACAGACGCTGTCCTCCAGTTCCCCAAGTCCCTCCAGGTCCTCACCGGTCCCTCCCAGCCCTGCCCACTCTGGAGCAGCGTGCCCG