Transcript asmbl_23614

Sequence
Transcript Sequence for observation asmbl_23614 of TGE0015196:
GCCGCATCTCCCTCAGTCGCCGCCGCTGGGGCCGCCACCGCCCGTCCTCGTCGCCCGAGCCCGGACACCATGCCACAGGAAGAGTGACCTCGTCCCTGTTTTCACGATGGAGGACTCGGGAAAGACATTCAGCTCTGAGGAGGAAGAAGCTAACTATTGGAAAGATCTGGCTATGACCTACAAGCAAAAGGCAGAGAATACACAAGAGGAGCTCCGAGAATTCCAGGAGGGAAGCCGAGAATATGAAGCTGAATTGGAGACGCAGCTGCAACAAATTGAGACCAGGAACAGGGACCTCCTGTCAGAAAATAACCGCCTTCGCATGGAGCTAGAAACCATCAAGGAGAAGTTTGAGACACAGCATTCTGAAGGCTACCGTCAGATCTCTGCCTTGGAGGGCGACCTCGCCCAGACCAAAGCCATCAAGGACCAGCTGCAGAAGTACATCCGTGAGCTGGAGCAAGCCAATGACGACCTGGAAAGAGCGAAACGGGCTACGATCATGTCTCTGGAAGATTTTGAGCAGCGTTTGAATCAAGCCATTGAAAGAAACGCCTTCCTGGAGAGCGAACTTGACGAGAAGGAGAATCTCCTAGAGTCTGTCCAGCGGCTGAAGGATGAAGCCAGAGATTTGCGGCAGGAATTGGCTGTGCAGCAGAAGCAGGAGAAACCCAGGACCCCCCTGCCCAACCCGGTGGAAGCCAGCAGGATAGACACTGCTGTGCAGGCCACTGGCTCCGTGCCATCTACCCCTGTGGCCCCCCGGGGACCCAGCTCCAGCTCAGCCACACCGGGGACGTTCAGACGCGGTCTGGAGGACTCCATGGGCGGGACTCCCCTCACACCCGCGGCCCGGATATCAGCGCTCAGCATCGTGGGAGACCTGCTGCGGAAAGTGGGGGCACTGGAGTCCAAACTTGCATCCTGCCGGAACTTCGTGTATGAGCAGTCCCCAAACCGAACAAGCGGCCCGGCCTCAGGACGGGGGAGCAAGAGCAGAGATGGCGGCGACAGACGGCCAGGCAGCACCAGCGCACCTCTGGCTGATAAAGGGTCGGGAAAACGCCTGGAATTTGGGAAGCCGCCTTCCAATCTGTCCTCGCCATCGCTGCCGTCAGCCCAGGGTGTAGTCAAGATGTTGCTTTAGAAAATCCACAGAAGCGAAGCTGCCGATGTCTGTGCGGGAGTTGTCACCTGTTCCCCTCTTTACACTAGGTTTTTATTTTTCTTTCTTTTTTTTTAAGTTAGTCTGAGAAATACGAGTGAACAGTCATACTAGCCATTGACTGAGGCTGATGCCTGTGGTCCCCGTGAACTGTTGTCTCGTGAACCCCAGCCTCCTTGTCAGTGTGTTGCAAACGGACCCCCCTGGAAGAGGGTGCTCAGGTGTGCTGCTGAGGCGACCCTGTCATTTCGAGCTGACCCGGGTCCTGCTTGGTCTCGAGAGGTGGTTTGAATGTCCACAGACGCCTCACGAATGGGATGTGAGCCACGTCGAGCCCACCCCGGCCCCACTTGGCACAGGATGGCACAGCAGGGTCAGCACGCTGAGAGCATGTCTAGGGGCGAAGGGTGGCCTGGGCACAAGCCTGTTTTTAAAACTGTGGTGTAGTGTACCTCCCACGCTTTTTATTCTGCCTCTCACGGAGGCTTTTAGAGGTGTGCTCAAGTTTTAGAGTAAATTTTGTGTGGACCAGGTCAGTGGAAAATCTGTGTCTTCTTTAGATCTGTCCCAACCGTTAATTGTCCTCGGTCCCCACCCCTCGCGTGGTGGGGGGGAGGACCTCCGCTTCAAGACCCTGAGGGTCACTGGGATGGAGTGGCCTCTTAATATGCAGCTTTTAAGAATAGGACTTTATTCAAGGCCATAATGACATAATCAGGGTGACCTTCAAATAAGATGACACCATCGCACACCAGGATTGTTGTCGGGAGCGTCCTTGTCAAAGGAGCAGCAAACACGAGATTTCCCACGCGGACGGGGTCTGTACTTAACCTCTGCTTGTGCGAGCTGCTGTCTCACGCTTTCGGTCACGTGTGAAAAGAACACAAAGTCAGGAGCATGTGTGTGCAGCTTAACGACCTTCCTTTTGTTACGAAGTTCTTTTTTCCAAAAGAACACCAAAATAGCCTTGATTTGAAAATAGACTCTTTCAAGTGTTACTAAAATTCAACAGAATCAAACCTCAGTGCTCAGTTCGTTACCCTACCAACATTCTAACCCAGGTCGACGAAAGATGTACCTTTACTTTTTTAAAAGAACAATAAAACCAAAAGAAACTAATTTTCA