Transcript asmbl_23613

Sequence
Transcript Sequence for observation asmbl_23613 of TGE0015196:
GCCGCATCTCCCTCAGTCGCCGCCGCTGGGGCCGCCACCGCCCGTCCTCGTCGCCCGAGCCCGGACACCATGCCACAGGAAGAGTGACCTCGTCCCTGTTTTCACGATGGAGGACTCGGGAAAGACATTCAGCTCTGAGGAGGAAGAAGCTAACTATTGGAAAGATCTGGCTATGACCTACAAGCAAAAGGCAGAGAATACACAAGAGGAGCTCCGAGAATTCCAGGAGGGAAGCCGAGAATATGAAGCTGAATTGGAGACGCAGCTGCAACAAATTGAGACCAGGAACAGGGACCTCCTGTCAGAAAATAACCGCCTTCGCATGGAGCTAGAAACCATCAAGGAGAAGTTTGAGACACAGCATTCTGAAGGCTACCGTCAGATCTCTGCCTTGGAGGGCGACCTCGCCCAGACCAAAGCCATCAAGGACCAGCTGCAGAAGTACATCCGTGAGCTGGAGCAAGCCAATGACGACCTGGAAAGAGCGAAACGGGCTACGATCATGTCTCTGGAAGATTTTGAGCAGCGTTTGAATCAAGCCATTGAAAGAAACGCCTTCCTGGAGAGCGAACTTGACGAGAAGGAGAATCTCCTAGAGTCTGTCCAGCGGCTGAAGGATGAAGCCAGAGATTTGCGGCAGGAATTGGCTGTGCAGCAGAAGCAGGAGAAACCCAGGACCCCCCTGCCCAACCCGGTGGAAGCCAGCAGGATAGACACTGCTGTGCAGGCCACTGGCTCCGTGCCATCTACCCCTGTGGCCCCCCGGGGACCCAGCTCCAGCTCAGCCACACCGGGGACGTTCAGACGCGGTCTGGAGGACTCCATGGGCGGGACTCCCCTCACACCCGCGGCCCGGATATCAGCGCTCAGCATCGTGGGAGACCTGCTGCGGAAAGTGGGGGCACTGGAGTCCAAACTTGCATCCTGCCGGAACTTCGTGTATGAGCAGTCCCCAAACCGAACAAGCGGCCCGGCCTCAGGACGGGGGAGCAAGAGCAGAGATGGCGGCGACAGACGGCCAGGCAGCACCAGCGCACCTCTGGCTGATAAAGGGTCGGGAAAACGCCTGGAATTTGGGAAGCCGCCTTCCAATCTGTCCTCGCCATCGCTGCCGTCAGCCCAGGGTGTAGTCAAGATGTTGCTTTAGAAAATCCACAGAAGCGAAGCTGCCGATGTCTGTGCGGGAGTTGTCACCTGTTCCCCTCTTTACACTAGGTTGGACACCAGTTGCCGCTGGTTGTCCAAATCGACGACCAGGTCGTCCAGCTCCGGCTGAAGCCTGTTCTTGGTCTTTTCCAGTTTGTCATAAGCAGCGGCCTTCTCTTCGTACTGCTGGGTGAGGCCTTCGAGTTCCTTCTGGAACCTCTTCTTGCCCTCTTCCAGGGACTCCACAGTGCTGGCAAAGTCCTGCAGCTTCTTCTTTGAATCGGAGAGCTGAAATGGCAGGGTTCAGAGTGGGCTGAGAGAAGGGCGGAGAGTGATTCCAATCCCTGGCCCCAGACCCTAAGAAGCCACCACCTTCTCACTGAAGAAACTGAACAGCAGGGGGAGCCAGTAAGCCCAGCAAAATGGTGCCCAGCTTCGCACAGTGCGTCAGCC