Transcript asmbl_23554

Sequence
Transcript Sequence for observation asmbl_23554 of TGE0015191:
CCGCGCTGCGAGCGGGGAGAACAGGTAGGGGAGCGGACATCCGCGGCTCCGGGAGAGGCTCGGGCAGCCGAGTCCCGCACCGCGCCCGGCGCGTCCCCGGCACCCGCGGCCTCTGGCGTTGAGGCGGGGGAGTAAGGAGATGCCGACCCAGAGGGACAGCACTACCATGTCTCACCCGATCGCAGGCGGCGGCAGCGGGGACCATTCGCACCAGGTCCGGGTGAAAGCTTACTACCGCGGGGATATCATGATAACACATTTTGAACCTTCAATCTCCTTTGAGGGCCTTTGCGGTGAGGTTCGAGACATGTGTTCTTTTGACAATGAACAGCTTTTCACTATGAAATGGATAGATGAGGAAGGAGACCCATGTACAGTATCATCTCAGCTGGAGTTAGAAGAAGCCTTTAGACTTTATGAGCTAAACAAGGACTCTGAACTCTTGATTCATGTCTTTCCTTGCGTACCAGAACGTCCTGGAATGCCCTGTCCAGGAGAAGATAAATCCATCTACCGCAGAGGTGCACGCCGATGGAGAAAGCTTTATTGTGCAAATGGCCACACTTTTCAAGCCAAGCGTTTCAACAGGCGTGCCCACTGTGCCATCTGTACTGATCGAATATGGGGACTAGGACGCCAGGGATATAAGTGCATCAATTGCAAACTCCTGGTTCATAAGAAGTGCCACAAACTTGTCACAATTGAATGTGGGCGGCATTCTTTGCCACCGGAGCCAATGATGCCCATGGATCCGTCATCCATGCACTCAGACCACGCACAGACAGTAATTCCATATAATCCTTCAAGTCATGAGAGTTTGGACCAAGTTGGTGAAGAAAAGGAGGCAATGAACACCAGGGAAAGTGGCAAAGCTTCATCCAGTCTAGGTCTTCAGGATTTTGATTTGCTCCGGGTAATAGGAAGAGGAAGTTATGCCAAAGTACTATTGGTGCGATTAAAAAAAACAGATCGTATTTATGCAATGAAGGTTGTGAAAAAAGAGCTTGTCAATGATGATGAGGATATTGATTGGGTACAGACAGAGAAGCATGTTTTTGAGCAAGCATCCAATCATCCCTTTCTTGTTGGGCTGCATTCTTGCTTTCAGACAGAAAGCAGATTGTTCTTTGTCATAGAGTATGTAAATGGAGGAGATCTAATGTTTCATATGCAGCGACAAAGAAAACTTCCTGAAGAACATGCCAGATTTTACTCTGCAGAAATCAGTCTAGCATTAAATTATCTTCATGAACGAGGGATAATTTATAGAGATTTGAAATTGGACAATGTATTGCTGGACTCAGAAGGACACATTAAACTCACTGACTACGGCATGTGTAAGGAAGGATTACGGCCAGGAGATACAACCAGCACTTTCTGTGGTACTCCCAATTACATCGCTCCTGAAATTTTAAGAGGAGAAGATTATGGATTCAGTGTTGACTGGTGGGCTCTCGGAGTACTAATGTTTGAGATGATGGCAGGAAGGTCTCCATTTGATATTGTTG